Primer and probe for RNA-isothermal-amplification detection on brucella abortus, kit and detection method
A constant temperature amplification detection technology for Brucella, applied in the direction of microorganism-based methods, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problem of high requirements for culture conditions and the inability to monitor the concentration of Brucella and bacteria in time low level problem
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment approach
[0149] According to some embodiments of the present invention, the probe sequence comprises: CCGGAUCCAACAAAAGAAAGAAAUCGCG, or at least 10 nucleotides in a homologous sequence thereof.
[0150] According to some embodiments of the present invention, the homologous sequence refers to a nucleotide sequence that is at least 70% identical to the sequence.
[0151] According to some embodiments of the present invention, the homologous sequence has at least 70% identical nucleotide sequence, for example at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 93%, A nucleotide sequence that is at least 95%, at least 97%, at least 98%, or at least 99% identical.
[0152] According to some embodiments of the present invention, the homologous sequence has substantially the same activity as the sequence disclosed in the present invention.
[0153] According to some embodiments of the present invention, the probe sequence comprises at least 10 nucleotide sequences, for examp...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


