Nucleic compound and production method thereof, and its use in the preparation of immune formulation

A production method and complex technology, applied in the direction of drug combination, bacterial antigenic components, viral antigenic components, etc., can solve the problems of easy degradation, complicated production, high cost, etc., achieve protection against pathogenic infection, easy industrial production, production method simple effect

Inactive Publication Date: 2005-04-20
王宾
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, adjuvants obtained from bacteria such as Freund's adjuvant can cause severe allergic reactions at the injection site, leading to the formation of induration or abscess; although cytokines can enhance the immune response, their toxicity increases with the increase of the dose. In addition, their production Complicated and costly; whether the synthetic nucleic acid or oligonucleotide is single-stranded or double-stranded, it is easily degraded in the body and cannot achieve its due effect; in addition, the above adjuvants are mainly aimed at the systemic immune system of animals. It can be achieved by injection, but its limitation is that it cannot mobilize an effective mucosal immune response, thereby limiting its application; polymer-encapsulated immune adjuvants are still in the experimental stage, and the manufacturing process is relatively cumbersome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic compound and production method thereof, and its use in the preparation of immune formulation
  • Nucleic compound and production method thereof, and its use in the preparation of immune formulation
  • Nucleic compound and production method thereof, and its use in the preparation of immune formulation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] The preparation of embodiment 1 single-stranded nucleic acid

[0022] The single-stranded oligonucleotide was synthesized by a standard automatic oligonucleotide synthesizer (such as ABI, Perceptive Biosystem Expedite 8909, etc.), and the synthesis method was synthesized according to a specific sequence (such as GATTGGACGTTAGTGACGTTAG) according to the method used by the instrument manufacturer. The synthesized oligonucleotide was deprotected, alcohol precipitated and dissolved in deionized water, and quantified at a wavelength of 260 nanometers by an ultraviolet spectrophotometer. Its purity can be analyzed by capillary electrophoresis. Endotoxin may be quantified.

Embodiment 2

[0023] The preparation of embodiment 2 double-stranded nucleic acid

[0024] Synthetic double-stranded nucleic acid is synthesized according to the method of Example 1, and is synthesized according to a specific sequence poly(dA-dT), and the synthesized nucleic acid is quantified at a wavelength of 260 nanometers by an ultraviolet spectrophotometer after deprotection, alcohol precipitation and deionized water dissolution .

[0025] Another method is to crush calf thymus tissue at low temperature, remove protein in phenol-chloroform solution, and separate double-stranded nucleic acid through ethanol precipitation. A detailed description of this technique can be found in "Molecular Cloning" by Sambrook et al. (Second Edition 1998, Cold Spring Harbor Laboratory Press, New York).

[0026] Another method is to extract plasmid DNA from E. coli, a detailed description of the method and technique can be found in "Molecular Cloning" by Sambrook et al. (Second Edition 1998, Cold Spring...

Embodiment 3

[0027] The preparation of embodiment 3 polypeptide

[0028] Peptides can be synthesized by a standard automatic peptide synthesizer (such as ABI, 433A, etc.), and the synthesis method is according to the method used by the instrument manufacturer; or extracted from animal tissues, cells or microorganisms according to conventional protein chemical methods, or can be extracted from genes Extracted from engineered expression bacteria or cells. These polypeptide extraction methods are well known and described in detail in "Protein Purification Protocols" by Doonan (1996, Humana Press, NJ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a nucleic acid compound, its production method and its application in the preparation of immune preparations. The invention is produced by copolymerization or covalent reaction of nucleic acid fragments, polypeptides and water-soluble polymers under catalytic conditions, and has the following general formula: nucleic acid / polypeptide / water-soluble polymer. The compound of the invention can not only protect the body against pathogen infection, anti-tumor and treat autoimmune diseases more safely and effectively, but also effectively stimulate the complete immune response of the body, and has simple production method, easy purification and industrial production. The complex of the present invention can be widely used in the preparation of various immune preparations.

Description

1. Technical field [0001] The present invention relates to a nucleic acid compound and its production method and its application in the preparation of immune preparations, especially the nucleic acid compound produced by copolymerization or covalent reaction of nucleic acid fragments, polypeptides and water-soluble polymers and its Production method and its application in the preparation of immune preparations. 2. Background technology [0002] The most important means of improving the body's immunity is vaccination. At present, there are many methods used to produce vaccines against infectious pathogens, such as inactivated vaccines, live attenuated vaccines, recombinant vaccines, subunit vaccines, and DNA vaccines. The antigenic substance is recognized by immune cells in the body to stimulate an immune response, so as to prevent the immune individual from being infected by infectious pathogens. In the use of various vaccine technologies, immune adjuvants play an importan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K39/02A61K39/12A61P37/02C08B37/00C08H1/00
Inventor王宾
Owner王宾