Method for promoting utilization of crops to soil phosphor phytate
A technology for crops and phytic acid, applied in the field of genetic engineering, to achieve the effects of improving utilization ability, accurate results and simple steps
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0069] 1. Construct an intermediate vector containing the nucleotide sequence shown in SEQ ID NO.1
[0070] 1.1 Synthetic signal peptide sequence: add XbaI site at the 5' end of the upstream fragment, and add SnaBI site at the 5' end of the downstream fragment. tctaga cccgggatatcatgggaagaattgctagaggctcaaaaatgagttctctcattgtgttct3' (SEQ ID NO. 2), downstream fragment: 5'ccggaattc tacgta agctgtggtttcggaagccaaattgagtgacacaatactacaagcaaagacacaatga 3' (SEQ ID NO.3), reaction system:
[0071] Upstream and downstream fragments (0.5μg / μl), each 6.0μl
[0072] 10X PCR buffer 5.0μl
[0073] dNTP (1.5mM each) 2.8μl
[0074] Taq Polymerase (5U / μl) 0.2μl
[0075] MgCl 2 (25mM) 5.0μl
[0076] h 2 O 24.2 μl
[0077]Reaction conditions: 94°C, 30Sec; 30°C, 1Min; 72°C, 20Min.
[0078] At the end of the reaction, 1 μl was taken, and the 150 bp band was clearly detected by electrophoresis. The fragments in the recovery reaction system are connected to the T-carrier. Digest the intermed...
Embodiment 2
[0151] 1. Construct an intermediate vector containing the nucleotide sequence shown in SEQ ID NO.1 (same as Example 1).
[0152] 2. Construction of plant recombinant expression vectors for rapeseed transformation
[0153] 2.1 Construction of phytase gene expression vector
[0154] Digest pBI525' with HindIII and EcoRI (see Pang, S.-Z., Nagpala, P., Wang, M., Slightom, J.L. & Gonsalves, D. (1992) Phytopathology, 82, 1223-1229 for the pBI525 vector construction process. , after the present invention cuts plasmid pBI525 with NcoI, treats it with Mungbean modifying enzyme to cut off the site, and then performs self-ligation, enzyme-cut connection and other methods are carried out according to conventional methods, and the plasmid after self-ligation is confirmed by sequencing that the NcoI site has been destroyed, named as pBI525') and pBINPLUS (Fred A. Van Engelenet al., Transgenic Research 4, 288-290), the about 900bp fragment containing the expression cassette elements double ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com