Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for promoting utilization of crops to soil phosphor phytate

A technology for crops and phytic acid, applied in the field of genetic engineering, to achieve the effects of improving utilization ability, accurate results and simple steps

Inactive Publication Date: 2007-08-08
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Improving the ability of plants to absorb and utilize phosphorus through transgenic technology. So far, the current research has only stayed at the level of model plants tobacco and Arabidopsis. There is still a lack of an effective way to improve the efficient absorption and utilization of crops. Phytate Phosphate Capacity Methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for promoting utilization of crops to soil phosphor phytate
  • Method for promoting utilization of crops to soil phosphor phytate
  • Method for promoting utilization of crops to soil phosphor phytate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] 1. Construct an intermediate vector containing the nucleotide sequence shown in SEQ ID NO.1

[0070] 1.1 Synthetic signal peptide sequence: add XbaI site at the 5' end of the upstream fragment, and add SnaBI site at the 5' end of the downstream fragment. tctaga cccgggatatcatgggaagaattgctagaggctcaaaaatgagttctctcattgtgttct3' (SEQ ID NO. 2), downstream fragment: 5'ccggaattc tacgta agctgtggtttcggaagccaaattgagtgacacaatactacaagcaaagacacaatga 3' (SEQ ID NO.3), reaction system:

[0071] Upstream and downstream fragments (0.5μg / μl), each 6.0μl

[0072] 10X PCR buffer 5.0μl

[0073] dNTP (1.5mM each) 2.8μl

[0074] Taq Polymerase (5U / μl) 0.2μl

[0075] MgCl 2 (25mM) 5.0μl

[0076] h 2 O 24.2 μl

[0077]Reaction conditions: 94°C, 30Sec; 30°C, 1Min; 72°C, 20Min.

[0078] At the end of the reaction, 1 μl was taken, and the 150 bp band was clearly detected by electrophoresis. The fragments in the recovery reaction system are connected to the T-carrier. Digest the intermed...

Embodiment 2

[0151] 1. Construct an intermediate vector containing the nucleotide sequence shown in SEQ ID NO.1 (same as Example 1).

[0152] 2. Construction of plant recombinant expression vectors for rapeseed transformation

[0153] 2.1 Construction of phytase gene expression vector

[0154] Digest pBI525' with HindIII and EcoRI (see Pang, S.-Z., Nagpala, P., Wang, M., Slightom, J.L. & Gonsalves, D. (1992) Phytopathology, 82, 1223-1229 for the pBI525 vector construction process. , after the present invention cuts plasmid pBI525 with NcoI, treats it with Mungbean modifying enzyme to cut off the site, and then performs self-ligation, enzyme-cut connection and other methods are carried out according to conventional methods, and the plasmid after self-ligation is confirmed by sequencing that the NcoI site has been destroyed, named as pBI525') and pBINPLUS (Fred A. Van Engelenet al., Transgenic Research 4, 288-290), the about 900bp fragment containing the expression cassette elements double ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides method to improve crop ulitization ability for earth closed phosphor element special the phosphor phytate, which comprises: operable linking the nucleotide sequence fused with nucleotide gene and signal peptide gene shown in SEQ ID NO.1 to behind promotor, constructing plant recombination expression vector; and transforming the vector into receptor crop. To security require, this invention method also comprises constructing plant select marker gene expression vector, transfers said vector with plant recombination expression vector into receptor crop, selective breeds to obtain expression acid without transgene plant. This invention continual expresses the phytase, and discharges out to degradate the phytic phosphor in earth and degrades into inorganic phosphor resource, and satisfies the phosphor require of crop.

Description

technical field [0001] The invention relates to a method for improving the ability of plants to utilize soil closed-storage phosphorus, in particular to a method for improving the ability of crops to use soil phytate phosphorus by using transgenic technology, which belongs to the field of genetic engineering. Background technique [0002] Phosphorus is one of the macroelements necessary for plant growth. In order to meet the nutritional requirements of crop growth and achieve high yield, a large amount of phosphorus fertilizer is applied every year during the crop growth season. However, a large number of studies have shown that after phosphorus fertilizer is applied to the soil, it can be quickly adsorbed to the surface of soil particles or form insoluble phosphate with some soil substances (Fe, Al, Ca, etc.), which greatly affects the concentration of phosphorus. Release and availability to plants. Phosphorus adsorption greatly reduces the availability of phosphate nutrie...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/62C12N15/55C12N15/82
Inventor 陈茹梅范云六薛光行方小平
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com