Maiignant malarial parasite msra-1 gene, protein product and use thereof

A technology of Plasmodium falciparum, residues, applied in genetic engineering, immunoglobulin, plant genetic improvement, etc., can solve the problem that the red endogenous antigen is not fully protected, it is difficult to obtain immune protection, and it is difficult to obtain malaria parasite protection. And other issues

Inactive Publication Date: 2004-06-30
THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies in the 1950s and 1960s on series of heterologous infections in malaria patients (such as Plasmodium falciparum followed by P. vivax) and cross-species experiments in the 1970s with irradiated cyclospores showed that it is difficult to o

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Maiignant malarial parasite msra-1 gene, protein product and use thereof
  • Maiignant malarial parasite msra-1 gene, protein product and use thereof
  • Maiignant malarial parasite msra-1 gene, protein product and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0012] Example 1: Cloning and sequence analysis of the Plasmodium falciparum protein msra-1 gene

[0013] Design primers (upstream primer: CGGGATCC AAGATGG ATGACATGTTTGCAAACCAA (Bold and italic is the BamHI restriction site, and the horizontal line is the Kozak fragment); downstream primer: CCCTCGAG TTA AGTTAGTAATAAATTATGAA (bold and italic is the XhoI restriction site, and the horizontal line is the termination site)) amplifies msra-1 from the genomic library of Plasmodium falciparum 3D7 strain (prepared by extracting DNA from the American ATCC standard 3D7 strain) For the full-length gene, 1 μl of amplification condition template, 4.5 μl of upstream and downstream primers, 30.75 μl of triple distilled water, 0.25 μl of ExtaqE, 5 μl of buffer, 4 μl of dNTP, and 50 μl of the total system. 94 pre-denaturation for 5 minutes, 10 cycles (denaturation at 94°C for 1 minute, annealing at 48°C for 1 minute, extension at 72°C for 1 minute), and then 20 cycles (denaturation at 94°C f...

Embodiment 2

[0015] Example 2: Recognition experiment of MSRA-1 N recombinant protein and patient serum

[0016] 1. Subcloning and expression of MSRA-1 N-terminal 180 amino acid peptide

[0017] Using WINSTAR software analysis, msra-1 gene N-terminal 67bp to 606bp sequence has high antigenicity. Design primers based on this sequence: upstream primer 5′CG GGATCC GATACAAATAATACA 3', which contains a BamHI site (underlined), downstream primer 5' CCG CTCGAG TTGAGGTTTATGA3', which contains an XhoI site (underlined), was amplified by PCR with this pair of primers from a pcDNA3.1-msra-1 recombinant clone (obtained by cloning the amplified msra-1 gene into pcDNA3.1) 540bp fragment. After this fragment was digested with BamHI and XhoI, it was subcloned into the Escherichia coli expression vector pGEX-4T-1 (ie, GST vector, obtained from Pharmacia). The correct clone was transformed into Escherichia coli BL21 (DE3) strain, induced by IPTG at 37°C for 2 hours, and a fusion recombinant protein of...

Embodiment 3

[0022] Embodiment 3: Indirect immunofluorescence analysis (IFA) detects the recognition of the polyclonal antiserum of anti-Plasmodium falciparum MSRA-1 protein and native protein

[0023] 1. Subcloning of the open reading frame (ORF) of msra-1

[0024] Primers were designed according to the sequence of msra-1: upstream: 5′CGGGATCC AAGATGG ATGACATGTTTGCAAACCAA 3′, BamHI site (bold italics) and Kozak fragment (underlined), downstream: 5′CCCTCGAG TTA AGTTAGTAATAAATTATGAA3', including XhoI site (bold and italic part) and termination site (underline), was amplified by PCR with this pair of primers to obtain a 1077bp fragment from the genome of Plasmodium falciparum ATCC standard 3D7 strain. After this fragment was digested with BamHI and XhoI, it was subcloned into the eukaryotic expression vector pcDNA3.1 (Invitrogen Company).

[0025] 2. Preparation of serum from immune mice

[0026] Use the recombinant vector plasmid obtained in 1 to immunize Balb / c mice to prepare polyclo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a pernicious malarial parasite new gene, called msra-1, coding a malaria infected patiendt serum recognizing antigen-1 of P.f from pernicious malarial parasite. It also relates to the new gene-coded protein product, and the immunological usage of the new gene and the protein at the aspect of anti-pernicious malarial parasite.

Description

technical field [0001] The present invention relates to a novel gene of Plasmodium falciparum named msra-1, which encodes a malaria infected patient serum recognizing antigen-1 of P.f from Plasmodium falciparum. The present invention also relates to the protein product encoded by the gene, and the immunological application of the gene and protein in anti-Plasmodium falciparum. Background technique [0002] Malaria is one of the deadliest epidemics in the world today. At present, there are nearly 4 billion people living in malaria endemic areas in the world, about 300-500 million new infections appear every year, and about 2-4 million people die from the disease every year. In the sub-Saharan region where malaria is the most severe, malaria consumes 1%-4% of the annual gross national product of about 12 billion U.S. dollars. Malaria has become the biggest obstacle to economic development in the region. The causative agent of malaria is Plasmodium. The life cycle of Plasmo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K31/7088A61P33/02C07H21/00C07K14/445C07K16/20C12N15/30C12N15/63
CPCY02A50/30
Inventor 王恒李会良吴溢敏韩志富邓禄琴
Owner THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap