Homoeotic box gene 9Brn-1 from quail and its use

A homology, amino acid technology, applied in the field of genetic engineering, can solve problems such as less work in birds

Inactive Publication Date: 2004-07-14
INSITUTE OF BIOPHYSICS CHINESE ACADEMY OF SCIENCES
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] So far, although POU proteins have been identified and their functions have been extensively studied in many animal species, very little work has been done on them in birds

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Homoeotic box gene 9Brn-1 from quail and its use
  • Homoeotic box gene 9Brn-1 from quail and its use
  • Homoeotic box gene 9Brn-1 from quail and its use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1: Molecular cloning and sequence determination of the cDNA of qBrn-1

[0026] Step 1: Preparation of Screening Library Probes

[0027] Chemically synthesize the following oligonucleotide sequences:

[0028] Primer 1: 5'CGACCTGGAGCAGTTCGCCAA 3'

[0029] Primer 2: 5'AACCAGACACGCACCACCT 3,

[0030] Quail embryos incubated for five days were taken, and cDNA was prepared by using mRNA purification Kit and cDNA synthesis Kit (Pharmacia Biotech) according to the method described in the manual. Using primer 1 and primer 2, use Taq DNA polymerase to carry out PCR reaction. After incubation at 97°C for 10 minutes, enter the following cycle: annealing at 55°C for 1 minute, extension at 72°C for 2 minutes, denaturation at 94°C for 1 minute, and cycle 35 times to obtain The DNA fragment of the screening library, which is cloned at the EcoRI site of the pBluescriptII SK-plasmid, has a total length of 402 bp, and its sequence is as follows:

[0031] 1 CGACCTGGAG CAGTTC...

Embodiment 2

[0045] Example 2: Determination of the restriction enzyme map of qBrn-1 cDNA and construction of various subclones

[0046] Step 1: Carry out single-digestion, double-digestion and multiple-digestion on the qBrn-1 clone of the present invention, and calculate the size of each digestion fragment by agarose gel electrophoresis, and analyze its multiple cloning site, and draw the restriction enzyme cut map, see figure 1 .

[0047] Step 2: qBrn-1 was double digested with Cla I and Sac I, and the digested fragment was recovered by agarose gel electrophoresis, and then pBluescript II KS was used as the carrier, and the same enzyme (ClaI and Sac I) was used It was double-digested, and finally subclone A was constructed by ligation reaction; in the same way, qBrn-1 was double-digested with BamHI and EcoR I to construct subclone B; qBrn-1 was double-digested with EcoRI and Cla I Digested with restriction enzymes to construct subclone C; single digested qBrn-1 with Pst I to construct ...

Embodiment 3

[0048] Embodiment 3: the preparation of antisense nucleic acid probe

[0049] The gene fragments in subclones B, C and D were selected as templates to prepare various antisense nucleic acid probes. The various subclones of the polynucleotide molecules of the present invention are shown in the accompanying drawings in Example 2, and the purpose of selecting three kinds of probes is to mutually verify the reliability of the results. The specific preparation method includes selecting an appropriate restriction enzyme to linearize the circular recombinant vector (i.e. subclone B, C and D), the restriction enzyme cutting site is located in the cDNA front of qBrn-1 Then use the polymerase (T3 polymerase or T7 polymerase) corresponding to the upstream of the 3' end of the positive strand of the cDNA to transcribe the linearized template in vitro, and the transcription product is the desired antisense nucleic acid probe.

[0050] In the present invention, in the in vitro transcriptio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a kind of qBrm-1 gene obtained through screening quail embryo cDNA, the gene encoded transcription regulation factor, the recombinant carrier, subclone and recombinant microbe containing the gene sequence and antisense probe obtained from these subclones. The gene is a kind of homoeotic cassette gene and has expression product as one new transcription regulation factor. Partial important functions of the homoeotic cassette gene and the transcription regulation factor in regulating and controlling the embryo growing process have been understood. The present invention aims at describing the functions via new gene research. In addition, the present invention also provides the application of the gene in regulating the growth of nervous system clinically.

Description

technical field [0001] The invention belongs to the field of genetic engineering, in particular, the invention relates to a new homeobox gene qBrn-1. The present invention also relates to the transcription regulator encoded by the gene, the recombinant vector containing the above gene sequence, its subclones and recombinant microorganisms, and the antisense probes obtained from these subclones. In addition, the present invention also relates to the application of the gene in regulating nervous system development in clinical medicine. technical background [0002] The nervous system is one of the earliest systems formed in animal embryonic development, and it plays a very important role in various life phenomena such as animal growth and development, regeneration, aging, behavior and learning. Neurodevelopmental biology is an important branch of developmental biology, and is currently the main field of research on phylogenetic developmental genes. The understanding of the r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/7088A61K38/17A61P25/00C07H21/00C07K14/435C07K16/18C12N15/11C12N15/63C12P21/02
Inventor兰蕾刘阳刘缨薛金晓薛志刚赫荣乔
OwnerINSITUTE OF BIOPHYSICS CHINESE ACADEMY OF SCIENCES