Process for preparing cytosine suanine dinuleotide sequence molecule immunopotentiator
An immune enhancer and dinucleotide technology, applied in the field of molecular immune enhancer preparation, can solve the problems of severe side effects of animals, incomplete and unsustainable immune protection of vaccines, etc., to enhance immune effect, ensure sustainable and healthy development, Boost your immune system
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0020] A kind of preparation method of cytosine guanine dinucleotide sequence molecular immunopotentiator of the present invention, its embodiment is as follows:
[0021] The sequence of the CpG DNA fragment used is:
[0022] 5’ TCCATGACGTTCCTGACGTT 3’
[0023] (Germany HMG Biotech GmbH company)
[0024] The CpG DNA fragment can be cloned into the pUC18 plasmid by using the conventional genetic engineering technology in the "Molecular Cloning Experiment Guide" to obtain a recombinant plasmid containing the CpG DNA fragment.
[0025] Then use the CaCl in the "Molecular Cloning Experiment Guide" 2 The transformation method introduces the plasmid into bacteria, which is a genetically engineered bacterium containing CpGDNA fragments.
[0026] The above-mentioned engineered bacteria were cultured overnight with LB medium whose components were 10g / l peptone, 5g / l sodium chloride and 5g / l yeast extract, and then collected 10ml of bacterium liquid. Resuspend with 0.5 ml of a solut...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com