Paddy rice stalk extension gene, coded protein and application thereof
A rice and protein technology, applied in the field of botany, can solve the problems of genes related to the rapid growth of plants that have not been disclosed
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0082] Cloning of rice stem elongation protein gene
[0083] Utilize the rice gene positioning cloning (map-based cloning or positioncloning) population that comprises the stem elongation protein gene Eui and its mutant gene eui that the inventor constructs, and those skilled in the art are clear, locate Eui / eui according to the molecular marker Within a small genome fragment, such as within 30kb. On this basis, a genomic DNA clone containing the fragment was isolated by a conventional method. It was identified by enzyme digestion and further hybridization that one of them contained the stem elongation protein Eui gene of the whole rice.
[0084] The result of the whole nucleotide sequence analysis shows that the full length of the rice stem elongation gene is 5900bp (SEQ ID NO: 1, including the regulatory region and the intron). According to software analysis and cDNA cloning, its ORF is shown in SEQ ID NO: 2, and it encodes rice stem elongation protein with a full length o...
Embodiment 2
[0089] Obtaining the Coding Sequence of Rice Stem Elongation Protein by RT-PCR
[0090] In order to verify the correctness of the sequence, according to the sequence of SEQ ID NO: 1, the following primers were designed and synthesized:
[0091] Forward primer 5'-3'ACGGAGGCCCATGAGCAAATTTCAA (SEQ ID NO: 4)
[0092] Reverse primer 5'-3' ACGTATCAGAGCCAGTCACAGCTTGG (SEQ ID NO: 5).
[0093] Correspondingly, in order to obtain the cDNA probe of the stem elongation protein gene, the following primers were designed and synthesized:
[0094] Forward primer 5'-3'ACCAGCGTCATCTTCAGCA (SEQ ID NO: 6)
[0095] Reverse primer 5'-3'AACGTCTCCCGCACCAC (SEQ ID NO: 7)
[0096] A 500bp cDNA probe was amplified by RT-PCR.
[0097] Rice Poly A extracted by conventional methods + RNA was used as a template for RT-PCR amplification. The amplification conditions were 94°C for 5 minutes, followed by 35 cycles of 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute, and finally extended at ...
Embodiment 3
[0099] Structural Analysis of Rice Stem Elongation Protein
[0100] According to the nucleotide sequence of cDNA (SEQ ID NO: 2), the sequence of the encoded stem elongation protein (SEQ ID NO: 3) was obtained. According to online query of protein database, stem elongation protein contains highly conserved cytochrome P450 domain. Therefore, it is concluded that the stem elongation protein is a P450 monooxygenase.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com