Unlock instant, AI-driven research and patent intelligence for your innovation.

Complete virus gene engineering vaccine of aftosa and its preparation method

A genetically engineered vaccine and a technology for foot-and-mouth disease virus are applied in the field of genetically engineered vaccines against foot-and-mouth disease and their preparation, and can solve problems such as difficult practical application value and difficult protection.

Inactive Publication Date: 2005-04-06
任兆钧
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, scientists all over the world agree that the ideal vaccine that can prevent the attack of virulent strains of foot-and-mouth disease should consist of all fragments of VP1, VP2, and VP3 of the surface protein of the whole virus particle to participate in the formation of an immune three-dimensional structure. Genetic engineering vaccines also need to take into account the spatial structure of the whole virus Otherwise, even if the subunit genetic engineering vaccine can produce immune detection reactivity, it is difficult to produce the protection of strong virulent attack. As a result, the actual pattern of molecular biology research of worldwide foot-and-mouth disease has been formed: only research value, no practical application value

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1: The O serotype foot-and-mouth disease genetically engineered vaccine that is mainly popular in Asia is obtained by the following preparation method:

[0028] 1. Take the O serotype foot-and-mouth disease virus strain, and use the imported Promega company TRIZOIL kit to extract its total genomic RNA.

[0029] 2. From the nucleic acid DNA sequencing information of published O serotype foot-and-mouth disease virus strains, design and synthesize the following two DNA nucleic acid probes, so that they are positioned at and cover the start and end sites of all structural protein genes on the surface of foot-and-mouth disease virus particles:

[0030] 5'CTCAACGCAGAATGGAAAGCA 3'

[0031] 5'GGTCGAAGTTCAGAAGCTGTT 3'

[0032] 3. Use the RT-PCR kit again, with the total RNA of the foot-and-mouth disease genome extracted as the substrate, and with the above probes as primers, carry out the RT-PCR chained DNA gene fragment amplification reaction to obtain the whole she...

Embodiment 2

[0036] Example 2: T4 phage exogenous protein high-efficiency expression display system expresses foot-and-mouth disease genetic engineering vaccine strain small animal test

[0037] The foot-and-mouth disease gene engineering vaccine, on the basis of positive laboratory immune response detection (PAGE polyacrylamide gel electrophoresis, Western Blotting immune hybridization, using pig and sheep foot-and-mouth disease serum antibodies, carried out immunogenic biological activity detection, all obtained Positive results), and then, successively in Sanda Biotechnology Company and Baoshan Foot-and-Mouth Disease Vaccine Factory, carried out the challenge protection effect test of pig-sourced and bovine-sourced FMD virulence in experimental small animals. The following two samples of our above-mentioned T4 bacteriophage foot-and-mouth disease genetically engineered vaccine were used in the test:

[0038] 1) T4 bacteriophage foot-and-mouth disease type O serotype whole virus expressi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kind of foot-and-mouth disease genetic engineering vaccine and its the preparing method.Its structure expression is: Entire virus genetic engineering vaccine: Phage T4-Soc-Hoc-FMDV-P1; Asian unit genetic engineering vaccine: Phage T4-Soc-Hoc-FMDV-F3.The preparing method is: Takes O blood serum foot-and-mouth disease virus poisonous, extracts total gene group RNA; From blood serum poisonous DNA measure foreword to synthesizes two DNA nucleic acid probe;takes the probe as the directing thing, carries on Rt-pcr chain type DNA expand increase response, obtains the viral granule P1gene;gene recombinate the P1gene and the T4bacteriophage material particle, pRH-Soc, obtains T4bacteriophage conformity material particle pRH-Soc-P1;homology reorganizes pRH-Soc-P1with the T4bacteriophage carrier phage T4- í¸ Soc & í¸ Hoc, then enters in the backwoods coli E.coli.CR63host mycelium, obtains this invention genetic engineering vaccine phage T4-Soc-FMDV-P1.compares this invention with the deactivation entire viral vaccine, it does not have to fight fire, maintains the entire viral antigenicity but not have the infection.may inject, also may take orally, convenient, quick, the immunity effect is good.

Description

technical field [0001] The invention relates to the field of medical and health technology, in particular to a foot-and-mouth disease genetic engineering vaccine created by using a T4 phage exogenous protein high-efficiency expression and display system and a preparation method thereof. Background technique [0002] Foot-and-mouth disease is a major infectious disease that endangers cloven-hoofed animals and humans. The International Veterinary Bureau and the Ministry of Agriculture of my country have listed it as a severe infectious disease of category A. my country's "Animal Epidemic Prevention Law" stipulates that it is the first category of serious infectious diseases. Vaccine immunization is the key to preventing and treating foot-and-mouth disease. fundamental technical measures. At present, the production of attenuated vaccines for the prevention of foot-and-mouth disease has generally stopped (due to the fear that the attenuated strains will mutate and return to the s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K39/00A61K39/135A61K48/00A61P31/14C07K14/01C07K14/09C07K14/18C12N15/86
CPCA61K39/00A61K2039/5256C07K2319/00C12N2770/32122A61K2039/62C12N15/86A61K2039/6075C12N2770/24022C07K14/005A61P31/14
Inventor 任兆钧
Owner 任兆钧
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More