Complete virus gene engineering vaccine of aftosa and its preparation method
A genetically engineered vaccine and a technology for foot-and-mouth disease virus are applied in the field of genetically engineered vaccines against foot-and-mouth disease and their preparation, and can solve problems such as difficult practical application value and difficult protection.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0027] Embodiment 1: The O serotype foot-and-mouth disease genetically engineered vaccine that is mainly popular in Asia is obtained by the following preparation method:
[0028] 1. Take the O serotype foot-and-mouth disease virus strain, and use the imported Promega company TRIZOIL kit to extract its total genomic RNA.
[0029] 2. From the nucleic acid DNA sequencing information of published O serotype foot-and-mouth disease virus strains, design and synthesize the following two DNA nucleic acid probes, so that they are positioned at and cover the start and end sites of all structural protein genes on the surface of foot-and-mouth disease virus particles:
[0030] 5'CTCAACGCAGAATGGAAAGCA 3'
[0031] 5'GGTCGAAGTTCAGAAGCTGTT 3'
[0032] 3. Use the RT-PCR kit again, with the total RNA of the foot-and-mouth disease genome extracted as the substrate, and with the above probes as primers, carry out the RT-PCR chained DNA gene fragment amplification reaction to obtain the whole she...
Embodiment 2
[0036] Example 2: T4 phage exogenous protein high-efficiency expression display system expresses foot-and-mouth disease genetic engineering vaccine strain small animal test
[0037] The foot-and-mouth disease gene engineering vaccine, on the basis of positive laboratory immune response detection (PAGE polyacrylamide gel electrophoresis, Western Blotting immune hybridization, using pig and sheep foot-and-mouth disease serum antibodies, carried out immunogenic biological activity detection, all obtained Positive results), and then, successively in Sanda Biotechnology Company and Baoshan Foot-and-Mouth Disease Vaccine Factory, carried out the challenge protection effect test of pig-sourced and bovine-sourced FMD virulence in experimental small animals. The following two samples of our above-mentioned T4 bacteriophage foot-and-mouth disease genetically engineered vaccine were used in the test:
[0038] 1) T4 bacteriophage foot-and-mouth disease type O serotype whole virus expressi...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com