Transduction peptide-insecticidal crystal protein fased protein and its corresponding sequence and use

A technology of insecticidal crystal protein and fusion protein, applied in the field of genetic engineering, can solve the problems of loss of receptor protein, decreased sensitivity of target sites, loss of insecticidal efficacy, etc., and achieve high insecticidal activity

Inactive Publication Date: 2005-10-19
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For Bt-resistant pests, because the receptor protein coding gene on the intestinal epithelial cells is mutated, the mutated receptor protein loses the ability to bind to the ICP domain II or III, which also leads to the inability of the ICP domain I to bind to the membrane. The effect forms perforation, and ICP loses its insecticidal effect (Gahan L.G., et al., Science.2001, 293:857-860; Griffitts J.S., et al., Science.2001, 293:860-864)
The reduced sensitivity of the target site caused by the mutation of the ICP binding site is the only known resistance mechanism by which pests develop resistance to Bt (Griffitts J.S., et al., Science.2001, 293: 860-864 )

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transduction peptide-insecticidal crystal protein fased protein and its corresponding sequence and use
  • Transduction peptide-insecticidal crystal protein fased protein and its corresponding sequence and use
  • Transduction peptide-insecticidal crystal protein fased protein and its corresponding sequence and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1, PTD and Cry1Ac gene vector construction scheme

[0043] When designing the base sequences of TAT and Rev, triplet codons highly expressed in Escherichia coli were selected. Design a cohesive linker connected to the pET21b vector EcoRI and NdeI restriction sites, and add a BamHI restriction site to the primer. The base sequence of PTD is as follows:

[0044] The gene primers for the toxic region of the Cry1Ac toxic protein are designed as follows, where Acb is the 5'-end upstream primer with a BamHI restriction site, Acs is the 3'-end downstream primer with a SalI restriction site, and the target gene fragment called out by PCR Ligated with pET21bPTD. Acn is the 5'-end upstream primer with NdeI restriction site, Acs is the 3'-end downstream primer with SalI restriction site, and the target gene fragment called out by PCR was ligated with pET21b as a control.

[0045] Acb 5'cgcggatccggataacaatccgaacatc3'

[0046] Acs 3′gctgagtcactacttgcgcagctgcgca5′

[...

Embodiment 2

[0049] Embodiment 2, the connection of PTD and pET21b carrier

[0050] The TAT peptide and Rev peptide were connected with the corresponding EcoRI / NdeI digestion products of pET21b, and transferred to JM110 host bacteria, and the plasmid DNA was extracted for detection, because the BamHI site in the pET21b plasmid had been excised, and the synthesis of TAT and Rev peptides A BamHI site was inserted. Therefore, BamHI restriction endonuclease can be used for detection, and the results are shown in figure 1 . It was shown that both PTDs were successfully linked to pET21b. The corresponding strains were sequenced by Shanghai Shenyou Company and Dalian Bao Biological Company, which was consistent with the designed synthetic sequence.

Embodiment 3

[0051] Embodiment 3, the cloning of CryIAc functional gene

[0052] Using the HD-73 model strain plasmid as a template, PCR amplification was carried out, and an amplified band of about 2.2kb was obtained. The product was recovered from the column, extracted and purified, digested with BamHI / SalI, connected with the BamHI / SalI product of pET21b, pET21bT, and pET21bR with an appropriate system, and transformed into Escherichia coli JM110. The obtained positive clone spots were detected by BamHI single enzyme digestion and BamHI / SalI double enzyme digestion (see figure 2 , 3). The results showed that the CryIAc functional gene fragment was successfully connected to the corresponding digestion products of pET21b, pET21bT, and pET21bR. Then, using the plasmid DNA of pET21bIAc, pET21bTIAc, and pET21bRIAc as a template, PCR amplification with CryIAc functional gene primers can obtain a 2.2 kb PCR product, indicating that the inserted fragment should be a CryIAc functional gene. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The present invention belongs to the field of gene engineering, relates to the constitution, expression and application of fusion protein, and is especially one kind of transduction peptide-insecticidal crystal protein fusing protein and its application. The PTD research results are applied in the field of microbial insecticidal crystal protein for the first time, so as to expand new field for applying PTD and open new way to eliminating pest's resistance. The fusion protein has pesticidal activity higher than that of single insecticidal crystal. The present invention has important theoretical and practical significance in controlling harmful organism and applying PTD.

Description

【Technical field】 [0001] The invention belongs to the field of genetic engineering, and in particular relates to the construction of a fusion protein sequence and the expression and application of the fusion protein. The invention specifically provides a transduction peptide-insecticidal crystal protein fusion protein and application thereof. 【Background technique】 [0002] Transduction peptide (Protein Transduction Domain, PTD) (Schwarze SR, et al., Science, 1999, 285: 1569-1572) is a class that can automatically penetrate the cell membrane and can be used as a carrier to carry other biological macromolecules into the cell membrane An arginine-rich polypeptide. In general, the cell membrane of eukaryotic cells is impermeable to most proteins and polypeptides longer than 6 amino acids. In 1988, Green et al. (Cell.1988, 55:1179-1188) reported that the transactivator TAT from AIDS virus 1 (HIV-1) added to the cell culture medium could automatically enter the cultured cells t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A01N37/18C07K19/00C12N15/62
Inventor张友军杨峰山张文吉吴青君徐宝云
OwnerINST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI