Novel fusion protein production and uses

A technology of fusion protein and thioredoxin, which is applied in the field of human acidic fibroblast growth factor variant fusion protein and its preparation, biotechnology and pharmaceuticals, and can solve the problems of poor stability of aFGF prototype

Inactive Publication Date: 2006-05-10
天津博发生物技术有限公司
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the stability of the aFGF prototype is relatively poor, and there are many limitations in clinical and practical applications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel fusion protein production and uses
  • Novel fusion protein production and uses
  • Novel fusion protein production and uses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Construction of Genetic Engineering Bacteria Recombinantly Expressing Human Acidic Fibroblast Growth Factor Variant Fusion Protein

[0028] (1) Artificially synthesize a double-stranded DNA gene encoding human aFGF 1-140 amino acid residues, and add an NcoI site at the 5' end, introduce an Ala residue at the N-terminus of the prototype haFGF, and add a SalI site at the 3' end, The sequence is as follows:

[0029] 5’…catggctttcaacctgccgccgggtaactacaaaaaaccgaaactgctgtactcctccaacggtggtcac

[0030] ttcctgcgtatcctgccggacggtaccgttgacggtacccgtgaccgttccgaccagcacatccagctgcagctg

[0031] tccgctgaatccgttggtgaagtttacatcaaatccaccgaaaccggtcagtacctggctatggacaccgacggt

[0032] ctgctgtacggttcccagaccccgaacgaagaatccctgttcctggaacgtctggaagaaaacccatacaacacc

[0033] tacatctccaaaaaacacgctgaaaaaaactggttcgttggtctgaaaaaaaacggttcctccaaacgtggtccg

[0034] cgtacccactacggtcagaaagctatcctgttcctgccgctgccggtttcctccgactaagtcgac...3'

[0035] The resulting DNA fragment was cloned with NcoI / SalI site ...

Embodiment 2

[0042] Purification of recombinant human acidic fibroblast growth factor variant fusion protein

[0043] The fermented liquid obtained from the fermentation culture was centrifuged in a refrigerated large-capacity centrifuge (7000rpm, 5min), and the bacteria were collected and washed three times with buffer solution (25mmol / L Tris, 0.15mol / L NaCl, pH8.0), and the culture medium was removed. the remains.

[0044] The fermented cells collected by centrifugation were uniformly suspended with buffer solution (25mmol / L Tris, 0.15mol / LNaCl, 1mmol / L EDTA, pH8.0) at a ratio of 20% (w / v), and cooled in an ice bath. Adjust the working pressure of APV 1000 homogenizer to destroy bacteria.

[0045] After the bacterial cell was crushed by high-pressure homogenization, the crude inclusion body was obtained by high-speed centrifugation (9000 rpm, 30 min). "7 mol / L guanidine hydrochloride, 50 mmol / L Tris, pH8.0" was used as the dissolution buffer of rhaFGF inclusion bodies. The rhaFGF incl...

Embodiment 3

[0054] Liquid and lyophilized preparations of Tioredoxin-aFGF fusion protein

[0055] The prescription of external recombinant human acidic fibroblast growth factor (fusion protein) lyophilized preparation is:

[0056] Fusion protein 1×10 5 IU (or 0.2mg)

[0057] Tris 3.02mg

[0058] NaCl 9mg

[0059] Human Albumin 10mg

[0060] Packed in 1.0ml / cartridge and then freeze-dried, that is, each finished product contains 1×10 5 IU (or 0.2 mg) rhaFGF, 9 mg NaCl, 3.02 mg Tris and 10 mg human albumin.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Specific activityaaaaaaaaaa
Login to View More

Abstract

The invention provides a production method and use of a novel fusion protein, in particular a human acidic fibroblast growth factor variant fusion protein and its preparing process, wherein the fusion protein is the fusion of human acidic fibroblast growth factor variant with thioredoxin, the fusion protein can be used for the treatment of wound healing.

Description

Technical field: [0001] The invention relates to a biotechnology drug, in particular to a human acidic fibroblast growth factor variant fusion protein and a preparation method thereof. The fusion protein is a fusion body of a human acidic fibroblast growth factor variant and thioredoxin , the fusion protein can be applied to fields such as wound healing therapy. Background technique: [0002] Human acidic fibroblast growth factor (Human acidic fibroblast growth factor, aFGF or haFGF for short) is one of the members of the cell growth factor family in the human body. It can promote the mitosis and differentiation of various cells such as epithelial cells and nerve cells. [0003] aFGF contributes to angiogenesis and injury repair, and has potential clinical value in the treatment of chronic soft tissue ulcers and venous stasis, diabetic leg and foot ulcers; Jefferson School of Medicine and Merck Sharp & Dohme Research Laboratories jointly completed aFGF promotes vascular rep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/12C12N15/62C12N15/70C12P21/00
Inventor彭隽赵全
Owner天津博发生物技术有限公司