Methods and constructs for increasing the content of selected amino acids in seeds

A technology of constructs and amino acids, applied in the field of plant biology, can solve problems such as abnormal seed physiology

Inactive Publication Date: 2006-05-31
BOREAL PLANT BREEDING
View PDF15 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The methods described above have certain drawbacks, and when large amounts of foreign proteins are expressed that have no functional role for the host plant, it can lead to many secondary problems related to physiological abnormalities of the seeds, as in equivalent types produced by traditional breeding methods. observed in mutants of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Methods and constructs for increasing the content of selected amino acids in seeds
  • Methods and constructs for increasing the content of selected amino acids in seeds
  • Methods and constructs for increasing the content of selected amino acids in seeds

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0092] Chromosomal DNA isolation and PCR

[0093] Chromosomal DNA was isolated as follows. Homogenize 300 μg of Arabidopsis leaf tissue into a fine powder in liquid nitrogen with a mortar. Then 3 ml of 100 mM Tris-HCl; pH 8.0, 500 mM NaCl, 50 mM EDTA were added, further triturated after adding 600 μl of 10% SDS and 500 μl of 20% polyvinylpyrrolidone (average molecular weight 360,000). The mixture was transferred to a polypropylene test tube and incubated at 65°C for 10 minutes. Then 450 μl of ice-cold potassium acetate was added to the solution, and the mixture was gently shaken by inverting the tube, incubated on ice for 30 minutes, and centrifuged at 8000 rpm for 10 minutes at 4°C. The supernatant was extracted with phenol / chloroform (1:1), and the DNA was precipitated with isopropanol. Precipitated DNA was washed with 70% ethanol, air-dried, and dissolved in 10 mM Tris-HCl; pH 8.0. The PCR reaction mixture included 1×PCR buffer (10× buffer: 500 mM KCl, 100 mM Tris-HCl; ...

Embodiment 2

[0095] Synthesis and cloning of histidine codon-enriched DNA sequences

[0096] To construct histidine codon-enriched DNA fragments, three chemically synthesized ssDNA fragments were used:

[0097] H-P-1 (SEQ ID NO: 1)

[0098] 5'-GCGCCTCGAGTTCACCATCACCATCATCACCATCACGGGCACCATCAC,

[0099] H-P-2 (SEQ ID NO: 2) 5'-CATCACCATCACCATGG and

[0100] H-M (SEQ ID NO: 3)

[0101] 5'-CCGGATCCTAAAGTCGACCATGGTGATGGTGATGGTGATGGTGCC.

[0102] In order to obtain dsDNA fragments with His codon-enriched sequences, oligonucleotides H-M and H-P-2 were dissolved in 1X AMV reverse transcriptase (RT) reaction buffer (50mM Tris-HCl; pH8.3, 50mM KCl, 10mM MgCl 2 , 0.5 mM spermidine, 10 mM DTT), annealed at room temperature for 30 minutes, and the chain extension reaction was carried out at 37°C for 45 minutes in the presence of 1X AMV RT buffer, 1 mM dNTPs and 1 unit of AMV RT. The reaction products were separated by agarose gel electrophoresis from unannealed oligonucleotides, purified, and inc...

Embodiment 3

[0104] Synthesis and cloning of cysteine ​​and methionine codon-enriched DNA sequences

[0105] For the construction of cysteine ​​and methionine codon-enriched DNA fragments, two chemically synthesized ssDNA fragments were used:

[0106] C-M-P-1 (SEQ ID NO: 4)

[0107] 5′CACCTCGAGTATGTTGTTGCATGTGCATGTGCTGTTGCATGTCGACAAAC 3′

[0108] and C-M-P-2 (SEQ ID NO: 5)

[0109] 5′GTTTGTCGACATGCAACAGCACATGCACATGCAACAACATACTCGAGGTG 3′

[0110] To obtain dsDNA fragments with Cys / Met codon-rich sequences, oligonucleotides C-M-P-1 and C-M-P-2 were incubated in 1X DNA polymerase I large (Klenow) fragment buffer (50 mM Tris-HCl; pH 7.2, 10mM MgSO 4 , 0.1 mM DTT) at room temperature for 30 minutes. A dsDNA fragment of the expected size (50bp) was excised from an agarose gel (after appropriate electrophoretic separation), purified, digested with XhoI and BamHI, and cloned into the similarly digested cloning vector pGEM-7Zf(+)( Promega Corporation, USA; catalog number P2251). After restri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides constructs and methods for increasing the content of selected amino acids by targeted expression or accumulation of amino acid sequence-rich proteins in plant species or in plant tissues or organs. Said increased levels are obtained by stably transforming plants with a recombinant nucleotide sequence construct encoding a carrier protein, having a polyamino acid extension at the 3'-end of said construct and operably linked to a tissue or on organ-specific regulatory sequences. The increased amino acid content in plant tissues, especially the membranous oil bodies and cell walls of seeds, provides a useful component for animal feed.

Description

field of invention [0001] The present invention relates generally to plant biotechnology. In particular, the present invention relates to methods and constructs for increasing the content of selected amino acids in plant species or plant tissues or organs, including cell walls, cell membranes, oil bodies, especially seeds. Said higher content is obtained by providing a recombinant nucleotide sequence construct encoding a carrier protein having a polyamino acid extension at its 3'-terminus. Compositions obtained by said methods are disclosed, as well as said amino acid enriched compositions and uses of plants, plant cells and cell lines transformed with one or more of said constructs. Background of the invention [0002] The eight essential amino acids are required in the diets of humans and livestock. Foods based primarily on a single grain or legume species lead to amino acid deficiencies due to the nutritional limitation of seed proteins, which have a negative impact on ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82
CPCC12N15/8251
InventorT·瓦尔罗斯J·阿塔贝科夫Y·多罗克霍夫P·苏西M·梅克莱T·科尔佩拉
OwnerBOREAL PLANT BREEDING