Unlock instant, AI-driven research and patent intelligence for your innovation.

Self-assembly composite nano granule tumor vaccine and method for preparing same

A composite nanoparticle and tumor vaccine technology is applied in the field of self-assembled composite nanoparticle tumor vaccine and its preparation, so as to achieve the effect of attacking and inhibiting and stimulating the body's immune system.

Inactive Publication Date: 2007-03-14
INST OF BASIC MEDICAL SCI ACAD OF MILITARY MEDICAL SCI OF PLA
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The current preparation technology of tumor vaccines cannot achieve the above-mentioned purpose. The present invention will develop self-assembled composite nanoparticle vaccine technology, realize the organic fusion of various immunological mechanisms and various vaccine forms, and greatly improve the immune protection effect of tumor vaccines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Self-assembly composite nano granule tumor vaccine and method for preparing same
  • Self-assembly composite nano granule tumor vaccine and method for preparing same
  • Self-assembly composite nano granule tumor vaccine and method for preparing same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1. Construction and Identification of Universal Tumor Vaccine Expression Vector pCI-pr-GPI

[0035] 1. Determine the general sequence

[0036] According to the technical scheme, the order of the general sequence is 5'-NheI-EcoRV-G-G-G-protamine gene-IgG Fc-GPI-Not-3'. Immunomodulatory molecule genes are inserted between NheI-EcoRV enzyme cutting sites, and the connecting arm composed of 3 Gs makes the expressed molecules have a certain degree of spatial freedom, which is easy to maintain their natural activity. The gene of the entire universal sequence has a total of 1472bp, and the sequence is as follows:

[0037] GCGGCTAGC(NheI)GATATC(EcoRV)GGAGGGGGA CGCTCCCAGTCCCGGAGCAGATACTACAGGCAGCGCCAGAGAAGCCGGAGGCGCAGAAGAAGGTCC GTTGGTGAGAGCTCAGCGCTCCTGCCTGGACGCATCCCGGCTATGCAGCCCCAGTCCAGGGCAGCAAGGCAGGCCCCGTCTGCCTCTTCACCCGGAGGCCTCTGCCCGCCCCACTCATGCTCAGGGAGAGGGTCTTCTGGCTTTTTCCCCAGGCTCTGGGCAGGCACAGGCTAGGTGCCCCTAACCCAGGCCCTGCACACAAAGGGGCAGGTGCTGGGCTCAGACCTGCCAAGAGCCATAT...

Embodiment 2

[0048]Example 2. Obtaining a tumor cell line that anchors and expresses related molecular elements (taking GM-CSF / Renca as an example)

[0049] 1. Acquisition of GM-CSF gene

[0050] Primers were designed according to the GM-CSF gene sequence on the gene bank, and Shanghai Sangon Bioengineering Co., Ltd. was commissioned to synthesize F1: GCGCTAGCAGCCTCTCAGCACCCACCCGCTCACC, R1: GC GATATCTTTTTGGACTGGTTTTTTGC.

[0051] Mouse PBMC cells were extracted and induced with 5ug / ml ConA for 4 hours, and total RNA was extracted for RT-PCR. For specific methods, see the Introgene Trozol kit instructions. After PCR amplification, a band appeared at the molecular weight of 400bp, which was sequenced as GM-CSF gene.

[0052] 2. Acquisition of pCI-pr-GPI / GM-CSF recombinant plasmid

[0053] After PCR amplification, the product was purified and the plasmid pCI-pr-GPI was digested with NheI and EcoRV respectively, and then the digested gene was connected to the plasmid, and after transformatio...

Embodiment 3

[0057] Embodiment three, self-assembled composite nanoparticle vaccine

[0058] 1. Obtain the cell membrane anchored and expressed by various related molecular elements

[0059] A total of 10 Renca cells modified with various related molecular elements were collected 8 For each, lyse the cells with hypotonic buffer (25mmol / L Tris-HCl.PH7.4) containing protease inhibitors, aspirate more than 3 times with a 27 gauge needle (4.5 gauge), mix well and centrifuge at 2,300rpm (2,000g) for 10min , take the supernatant (containing membrane components). Centrifuge at 25,400rpm (22,000g) for 30min to collect the precipitate.

[0060] 2. Formation of composite nanoparticle vaccine

[0061] Wash twice with solution I (0.15mol / L NaCl, 10mmol / L Tris, pH8.0), wash with solution II (0.14mol / L NaCl, 25mmol / L Tris-HCl, pH7.4, which contains 2% 1- S-Octyl Beta-D-thioglucopyranoside) dissolved to a concentration of 10 8 cells / mL, shake at 4°C for 30 min. Take the supernatant by centrifugatio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a self-combine compound nanometer cancer vaccine, and relative production. Wherein, said vaccine is formed by cancer cell membrane, protein molecule and DNA particle; the invention builds the cancer antigen molecule and immunologic adjuvant molecule on the eucaryon expression carrier, to anchor and express on the surface of cancer cell; then mixing the cells, to extract cell membrane, and decompose the cell membrane into the membrane liposome with anchored protein molecule, to be mixed with the DNA particles of cancer antigen molecule, immunity adjusting molecule, in certain buffer condition, to form the nanometer cancer vaccine. The invention can be used to treat several carcinomas, contagion, and non-contagion.

Description

technical field [0001] The invention relates to a novel therapeutic tumor vaccine, in particular to a self-assembled composite nanoparticle tumor vaccine and a preparation method thereof. Background technique [0002] Tumor vaccine is an important method in tumor biotherapy. It stimulates the body's immune system to specifically recognize and kill tumor cells in vivo. In terms of preventing tumor recurrence and metastasis, tumor vaccines have unique advantages that cannot be compared with the three traditional treatments of surgery, chemotherapy and radiotherapy [Mocellin S, et al Cancer vaccine development: on the way to break immunetolerance to malignant cells. Exp Cell Res .2004;299(2):267-78]. [0003] Tumor vaccines have been researched and developed in the following forms: (1) Vaccines based on whole tumor cells: tumor lysates, gene-transfected tumor cells, tumor cell RNA vaccines, etc.; (2) Tumor antigen vaccines : Based on specific tumor antigens, including peptide...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00A61K9/14A61K39/395A61P35/00
Inventor 于继云修冰水阎瑾琦刘荷中陈兴刘颖黄悦胡巍
Owner INST OF BASIC MEDICAL SCI ACAD OF MILITARY MEDICAL SCI OF PLA