Recombinant IL4 antibodies useful in treatment of IL4 mediated disorders
a technology of recombinant il4 and antibodies, applied in the field of fusion proteins, can solve the problems of not waning the reduction of ige levels
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Production of MAb 3B9
[0126] A. Immunization Procedure
[0127] Four mice (F1 hybrids of Balb / c and C57BL / 6) were immunized subcutaneously with 50 μg recombinant E. coli human IL4 in Freunds complete adjuvant and 4 weeks later boosted intraperitoneally (i.p.) with 50 μg IL4 in Freunds incomplete adjuvant. On the basis of a good serum antibody titre to IL4 one mouse received further immunizations of 200 μg IL4 (i.p. in saline) at 8 weeks, two days later with 100 μg IL4 (i.p. in saline) and two days later with 50 μg IL4 (i.p. in saline). Two days following the final immunization a splenectomy was performed.
[0128] B. Fusion Procedure and Screening System
[0129] Mouse spleen cells were used to prepare hydridomas (by standard procedures, e.g. as described by Kohler et al, Nature, 256:495 (1975)) from which >250 clones of cells were screened for secretion of antibody to IL4, using the commercially available BIAcore system, and ELISA assays as described below, for IL4 binding. Five wells ga...
example 2
ELISA Assays and Affinity Constants
[0130] A. ELISA
[0131] The screening assay, performed as follows, was designed to measure affinity for native human IL4. For experiment 1 aldehyde activated 96-well plates were coated with IL4 at 1 μg / mL, 100 μl / well in 0.1 M borate buffer, pH 8.5, and incubated overnight at RT. The hIL4 was covalently attached to the plate. IL4 solution was aspirated and non-specific binding (NSB) sites were blocked with 1% bovine serum albumin (BSA) in TBS buffer (50 mM Tris, 150 mM NaCl, 1 mM MgCl2, 0.02% NaN3, pH 7.4) for 60 minutes at 37° C. Following this and each of the following steps, the plate was washed 4 times in wash buffer (10 mM Tris, 150 mM NaCl, 0.05% Tween 20, 0.029% NaN3, pH 7.4). Following this, 50 μL hybridoma medium (or purified 3B9 or Fab fragments) and 50 μL assay buffer (05% bovine gamma globulin in TBS buffer) was added and the plates were incubated for 60 minutes at 37° C. One hundred μL of biotinylated anti-mouse antibody was added per ...
example 3
[0145] One humanized antibody was designed to contain murine CDRs within a human antibody framework. This humanized version of the IL4 specific mouse antibody 3B9, was prepared by performing the following manipulations.
[0146] A. cDNA Cloning
[0147] cDNA clones were made of the 3B9 heavy and light chains from mRNA extracted out of the 3B9 hybridoma cell line [Example 1] using a Boehringer Mannheim kit. Primers specific for either the mouse hinge region or kappa constant region were used for first stand synthesis.
The kappa chain primer is [SEQ ID NO: 29]:5′-CTAACACTCATTCCTGTTGAAGCTCTTGACAATGGG-3′The gamma heavy chain primer is [SEQ ID NO: 30]:5′ GTACATATGCAAGGCTTACAACCACAATC 3′.
[0148] The double stranded cDNA was cloned directly into plasmids pGEM7f+ [Promega] that were then transformed into E. coli DH5-α [Bethesda Research Labs].
[0149] B. DNA Sequencing
[0150] Eight heavy and one light chain murine cDNA clones from Part A above were sequenced. The results of se...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Fraction | aaaaa | aaaaa |
| Molar density | aaaaa | aaaaa |
| Current | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More