Malaria immunogen and vaccine

a technology of immunogen and malaria, applied in the field of immunogen and vaccine, can solve the problems of not being able to effectively fight any form of malaria, being less attractive to the immediate needs of travelers and the military, and unable to use them as vaccines in vitro, etc., and achieves the effect of high antibody titers, easy preparation, and high antibody titers

Inactive Publication Date: 2005-09-22
MILICH DAVID +1
View PDF1 Cites 22 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

"The present invention is about a new immunogen that can be used as a vaccine to protect against malaria caused by the parasite Plasmodium. The immunogen is a recombinant hepatitis B virus core (HBc) protein chimer molecule that contains four peptide-linked amino acid residue sequence domains from the N-terminus of HBc. The immunogen is designed to induce antibodies that specifically recognize the parasite species Plasmodium falciparum and Plasmodium vivax. The immunogen is easily prepared using well-known cell culture techniques and is stable at high temperatures. It is also free of nucleic acids. The use of this immunogen as a vaccine can provide high antibody titers against the Plasmodium species."

Problems solved by technology

Presently, there is not an effective vaccine against any form of malaria.
This vaccine approach is more attractive as a long-term global solution to eradication of malaria and less attractive to the immediate needs of travelers and the military forces.
However, an inability to culture sporozoites in vitro thwarted the possibility of using them as a vaccine.
The limited effectiveness of this vaccine was attributed to suboptimal levels of anti-NANP antibodies.
Attempts to increase dosage were hindered by toxicity of the TT carrier.
Further, the lack of parasite-derived determinants capable of priming malaria-specific T cells also likely contributed to the low levels of protection.
Short synthetic peptides often have an in vivo half-life that is too short for them to be effective as prophylactic or therapeutic drugs.
However, the level of protection was not sufficient to warrant larger trials of this particular candidate.
A major shortfall of this vaccine was that it did not provide an efficient source of T cell help.
However, this sequence is known to be a Th epitope for only a limited number of individuals; i.e. it is highly genetically restricted.
Although MAPs have proven to be excellent research tools, providing valuable insight into immune recognition of the CS protein, there are several intrinsic problems associated with using them in a commercial vaccine.
Their commercial utility has yet to be established relative to manufacturing and cost issues.
Thus, many chimeric HBc particles are so unstable that they fall apart during purification to such an extent that they are unrecoverable or they show very poor stability characteristics, making them problematic for vaccine development.
A first potential problem is the inadvertent transfer of nucleic acids in a chimer vaccine to an immunized host.
A second potential problem is interference from preexisting immunity to HBc.
A third possible problem relates to the requirement of reproducible preparation of intact chimer particles that can also withstand long-term storage.
Secondly, vaccinees living in malaria endemic regions experience natural ‘boosting’ every time they are exposed to the parasite, because their immune systems have been primed at both the B and Th cell level.
This effect is similar to clinical boosting by re-vaccination, a process that can be difficult to coordinate in developing countries where malaria is endemic.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Malaria immunogen and vaccine
  • Malaria immunogen and vaccine
  • Malaria immunogen and vaccine

Examples

Experimental program
Comparison scheme
Effect test

example 1

B Cell Epitope-Containing

[0226] Chimer Preparation

[0227] A. Preparation of Plasmid Vector pKK223-3N, a Modified Form of pKK223-3

[0228] Plasmid vector pKK223-3 (Pharmacia) was modified by the establishment of a unique NcoI restriction site to enable insertion of HBc genes as NcoI-HindIII restriction fragments and subsequent expression in E. coli host cells. To modify the pKK223-3 plasmid vector, a new SphI-HindIII fragment was prepared using the PCR primers pKK223-3 / 433-452-F and pKK223-NcoI-mod-R, and pKK223-3 as the template.

[0229] This PCR fragment was cut with the restriction enzymes SphI and HindIII to provide a 467 bp fragment that was then ligated with a 4106 bp fragment of the pKK223-3 vector, to effectively replace the original 480 bp SphI-HindIII fragment. The resultant plasmid (pKK223-3N) is therefore 13 bp shorter than the parent plasmid and contains modified nucleotide sequence upstream of the introduced NcoI site (see FIG. 1 in which the dashes indicate the absent b...

example 2

P. vivax Universal T Cell Epitope

[0245]

Pv-UTC  I  E  Y  L  D  K  V  R  A  T  V  G  T  E  W  T  PAATTGAATATCTGGATAAAGTGCGTGCGACCGTTGGCACGGAATGGACTCCGT    CTTATAGACCTATTTCACGCACGCTGGCAACCGTGCCTTACCTGAGGCA          C  S  V  T  #  #SEQ ID NO: 100          GCAGCGTGACCTAATASEQ ID NO: 101          CGTCGCACTGGATTATTCGASEQ ID NO: 102A. PCR primers for site-directed mutagenesisPf-CS(C17A)-RSEQ ID NO: 103        #  #  T  V  S  A  P  S  W  E  T  SGCCAAGCTTACTAGGTAACGGAGGCCGGAGACCATTCGGTGGHindIIISEQ ID NO: 104

[0246] B. PCR Primers for Truncation and Cysteine Addition at C-terminus

[0247] To modify the C-terminus of HBc chimer genes, either via the addition of cysteine residues or varying the length of the HBc gene, PCR reactions were performed using HBc149 as template with the HBc / NcoI-F primer and a reverse primer (e.g. HBc149+C / HindIII-R) that directed the desired modification of the C-terminus. PCR products were digested with NcoI and HindIII (whose restriction sites are underlined), and clo...

example 3

Assay Procedures

[0248] A. Antigenicity

[0249] 1. Particle ELISA

[0250] Purified particles were diluted to a concentration of 10 μg / mL in coating buffer (50 mM sodium bicarbonate, pH 9.6) and coated onto the wells of ELISA strips (50 μL / well). The ELISA strips were incubated at room temperature overnight (about 18 hours). Next morning, the wells were washed with ELISA wash buffer [phosphate buffered saline (PBS), pH 7.4, 0.05% Tween®-20] and blocked with 3% BSA in PBS for 1 hour (75 μL / well). ELISA strips were stored, dry, at −20° C. until needed.

[0251] To determine the antigenicity of particles, antisera were diluted using 1% BSA in PBS and 50 μL / well added to antigen-coated ELISA wells. Sera were incubated for 1 hour, washed with ELISA wash buffer (above) and probed using an anti-mouse (IgG)—HRP (The Binding Site, San Diego, Calif.; HRP=horseradish peroxidase) conjugate (50 μL / well) or other appropriate antibody for 30 minutes. After washing with ELISA wash buffer the reaction wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
timeaaaaaaaaaa
Login to View More

Abstract

A chimeric, carboxy-terminal truncated hepatitis B virus nucleocapsid protein (HBc) is disclosed that contains an immunogen for inducing the production of antibodies to malarial proteins. An immunogenic malarial epitope is expressed between residues 78 and 79 of the HBc immunogenic loop sequence. The chimer preferably contains a malaria-specific T cell epitope and is preferably engineered for both enhanced stability of self-assembled particles and enhanced yield of those chimeric particles. Methods of making and using the chimers are also disclosed.

Description

CROSS-REFERENCE TO RELATED APPLICATION [0001] This is a continuation-in-part of application Ser. No. 60 / 225,813, filed Aug. 16, 2000, whose disclosures are incorporated herein by reference.TECHNICAL FIELD [0002] The present invention relates to the intersection of the fields of immunology and protein engineering, and particularly to an immunogen and vaccine useful in prevention of malaria infection by P. falciparum or P. vivax. BACKGROUND OF THE INVENTION [0003] Malaria is by far the world's most important tropical parasitic disease, killing more people than any other communicable disease, with the exception of tuberculosis. The causative agents in humans are four species of Plasmodium protozoa: P. falciparum, P. vivax, P. ovale and P. malariae. Although P. falciparum accounts for the majority of infections and is responsible for the vast majority of deaths attributable to malaria, P. vivax causes a recurring chronic debilitating disease for which a vaccine is necessary. [0004] Mala...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): A61KA61K39/015A61P33/06C07K14/445C12N15/82
CPCA61K39/015A61K2039/6075C12N15/8257C07K2319/00C07K14/445A61P33/06Y02A50/30
InventorMILICH, DAVIDBIRKETT, ASHLEY
OwnerMILICH DAVID