Unlock instant, AI-driven research and patent intelligence for your innovation.

Novel DNA polymerase

a dna polymerase and primer technology, applied in the field of dna polymerases, can solve the problem that enzyme is not suitable for the synthesis of long cdnas, and achieve the effect of strong primer extension activity and weak activity

Inactive Publication Date: 2014-12-11
KYUSHU UNIV
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The patent text describes a device or system that allows for better control and management of power distribution in a network. This can improve the reliability and stability of the network, as well as reduce the likelihood of downtime or malfunctions. Overall, the device or system can make it easier and more effective to operate and maintain a network.

Problems solved by technology

Family B enzymes are not suitable for nucleotide sequencing because of poor incorporation of dideoxynucleotides but have 3′-5′ exonuclease activity which is involved in the accuracy in synthesizing DNA strands according to the sequences of template strands—during amplification, the enzymes of this family produce less errors than Family A enzymes such as Taq polymerases with no exonuclease activity.
Since the optimum temperature of this enzyme is high, the enzyme makes it possible to perform a reverse transcription reaction at relatively high temperatures (around 60° C.) and is also effective for the reverse transcription of RNA which easily forms a three-dimensional structure, but the enzyme is not suitable for the synthesis of long cDNAs like those reaching as long as several kilo bases in length.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel DNA polymerase
  • Novel DNA polymerase
  • Novel DNA polymerase

Examples

Experimental program
Comparison scheme
Effect test

example 1

Construction of Mutants

1. Introduction of Mutations:

[0073]In order to construct each of amino acid substitution mutants of a Taq polymerase, one or more site-specific mutations were introduced in a primer dependent manner by PCR using one or more sets of primers having sequences designed to ensure that a mutation is applied to a position of interest, with an expression plasmid having a Taq polymerase gene inserted therein being used as a template. The introduction of one or more site-specific mutations into a Taq polymerase was performed using one or more sets of primers shown below. The amino acid substitution sites employed to construct the respective mutants are underlined.

[Formula 1]ExoTaq117119A-F(SEQ ID NO: 1)CTCGAGGTCCCGGGCTACGCGGCGGCCGACGTCCTGGCCAGCCTGTaq117119A-R(SEQ ID NO: 2)CACGCTGGCCAGGACGTCGGCCGCCGCGTAGCCGGGACCTCGAGTaq142144A-F(SEQ ID NO: 3)GTCCGCATCCTCACCGCCGCCAAAGCCCTTTACCAGCTCCTTTCCTaq142144A-R(SEQ ID NO: 4)GGAAAGGAGCTGGTAAAGGGCTTTGGCGGCGGTGAGGATGCGGAC[Formula 2]Exo ...

example 2

Evaluation of Mutants

1. Transcriptional Activity:

[0078]In order to determine the basic DNA polymerase activity of each of the purified enzymes, a world-wide standard method was used. More specifically, the intensity of the activity of incorporating deoxyribonucleotides on a DNA template strand was determined, and the activity per unit protein amount was calculated in units. To perform a nucleotide incorporation reaction, a reaction mixture was prepared by adding 0.2 mg / mL of activated DNA (obtained by treating a calf thymus DNA with DNase I to partially nick or gap a double-strand DNA), 0.2 mM dNTP, 440 nM [3H]-dTTP, 50 mM Tris-HCl (pH 8.0), 1.5 mM MgCl2, 50 mM KCl, 0.1% TritonX-100, 100 μg / mL of BSA, and 1 nM DNA polymerase, and the mixture was reacted at 72° C.; then, 10 μL of the mixture was spotted onto DE81 paper. After air-dried for 10 minutes, the paper was washed with an aqueous 5% disodium hydrogenphosphate solution to remove unreacted nucleotides. The washing was repeated ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
temperatureaaaaaaaaaa
temperaturesaaaaaaaaaa
growth temperatureaaaaaaaaaa
Login to View More

Abstract

Provided are various novel DNA polymerases.Provided are: a DNA polymerase comprising: an amino acid sequence modified from the amino acid sequence of SEQ ID NO: 12, which has a substitution of arginine at position 651 by an amino acid residue having a negatively charged side chain, preferably by asparatic acid or glutamic acid, more preferably by glutamic acid; and a DNA polymerase comprising an amino acid sequence modified from the amino acid sequence of SEQ ID NO: 14, which has a substitution of proline at position 653 by an amino acid residue having a negatively charged side chain, preferably by asparatic acid or glutamic acid, more preferably by glutamic acid.

Description

TECHNICAL FIELD[0001]The present invention relates to novel DNA polymerases. The DNA polymerases of this invention are particularly useful for PCR.BACKGROUND ART[0002]DNA polymerases are enzymes that can synthesize new DNA strands along template DNA strands in vitro. DNA polymerases can synthesize new DNA strands from a template DNA, an oligonucleotide serving as a primer, and four types of deoxynucleotides (dATP, dGTP, dCTP, and dTTP). DNA polymerases are also used in many genetic engineering techniques, including nucleotide sequencing and PCR.[0003]Thermostability of polymerases is essential for PCR, and the current protocol of nucleotide sequencing generally uses the cycle sequencing method using a thermostable DNA polymerase as a standard technique. In order to find a thermostable enzyme, one would usually search enzymes produced by thermophilic microorganisms. Among thermophilic bacteria, those which proliferate at an optimum growth temperature of at least 80° C. are particular...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12N9/12
CPCC12N9/1252C12P19/34C12Y207/07007C12N1/00C12N1/20C12N15/63Y02P20/52
Inventor ISHINO, YOSHIZUMIYAMAGAMI, TAKESHIMATSUKAWA, HIROAKI
Owner KYUSHU UNIV