Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Microbial fermentation for the production of terpenes

a technology of terpenes and fermentation, which is applied in the direction of transferases, lyases, carbon-carbon lyases, etc., can solve the problems of not all bacteria comprise the necessary cellular machinery to produce terpenes and/or their precursors, and most bacteria are not known to produce any terpenes, etc., and achieve the effect of increasing the number of copies

Inactive Publication Date: 2015-07-09
LANZATECH NZ INC
View PDF8 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The patent provides a way to make enzymes that can convert CO into terpenes and their precursors when expressed in a microorganism. This can help create a system for making these compounds through fermentation.

Problems solved by technology

However, not all bacteria comprise the necessary cellular machinery to produce terpenes and / or their precursors as metabolic products.
In addition, most bacteria are not known to produce any terpenes which are of commercial value.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microbial fermentation for the production of terpenes
  • Microbial fermentation for the production of terpenes
  • Microbial fermentation for the production of terpenes

Examples

Experimental program
Comparison scheme
Effect test

example 1

Expression of Isoprene Synthase in C. autoethanogenum for Production of Isoprene from CO

[0443]The inventors have identified terpene biosynthesis genes in carboxydotrophic acetogens such as C. autoethanogenum and C. ljungdahlii. A recombinant organism was engineered to produce isoprene. Isoprene is naturally emitted by some plant such as poplar to protect its leave from UV radiation. Isoprene synthase (EC 4.2.3.27) gene of Poplar was codon optimized and introduced into a carboxydotrophic acetogen C. autoethanogenum to produce isoprene from CO. The enzyme takes key intermediate DMAPP (Dimethylallyl diphosphate) of terpenoid biosynthesis to isoprene in an irreversible reaction (FIG. 1).

Strains and Growth Conditions:

[0444]All subcloning steps were performed in E. coli using standard strains and growth conditions as described earlier (Sambrook et al, Molecular Cloning: A laboratory Manual, Cold Spring Harbour Labrotary Press, Cold Spring Harbour, 1989; Ausubel et al, Current protocols in...

example 2

Expression of Isopentenyl-Diphosphate Delta-Isomerase to Convert Between Key Terpene Precursors DMAPP (Dimethylallyl Diphosphate) and IPP (Isopentenyl Diphosphate)

[0459]Availability and balance of precursors DMAPP (Dimethylallyl diphosphate) and IPP (Isopentenyl diphosphate) is crucial for production of terpenes. While the DXS pathway synthesizes both IPP and DMAPP equally, in the mevalonate pathway the only product is IPP. Production of isoprene requires only the precursor DMAPP to be present in conjunction with an isoprene synthase, while for production of higher terpenes and terpenoids, it is required to have equal amounts of IPP and DMAPP available to produce Geranyl-PP by a geranyltransferase.

Construction of Isopentenyl-Diphosphate Delta-Isomerase Expression Plasmid:

[0460]An Isopentenyl-diphosphate delta-isomerase gene idi from C. beijerinckii (Gene ID:5294264), encoding an Isopentenyl-diphosphate delta-isomerase (YP—001310174.1), was cloned downstream of ispS. The gene was amp...

example 3

Overexpression of DXS Pathway

[0465]To improve flow through the DXS pathway, genes of the pathway were overexpressed. The initial step of the pathway, converting pyruvate and D-glyceraldehyde-3-phosphate (G3P) into deoxyxylulose 5-phosphate (DXP / DXPS / DOXP), is catalyzed by an deoxyxylulose 5-phosphate synthase (DXS).

Construction of DXS Overexpression Expression Plasmid:

[0466]The dxs gene of C. autoethanogenum was amplified from genomic DNA with oligonucleotides Dxs-SalI-F (SEQ ID NO: 29: GCAGTCGACTTTATTAAAGGGATAGATAA) and Dxs-XhoI-R (SEQ ID NO: 30: TGCTCGAGTTAAAATATATGACTTACCTCTG) as described for other genes above. The amplified gene was then cloned into plasmid pMTL85246-ispS-idi with SalI and XhoI to produce plasmid pMTL85246-ispS-idi-dxs (SEQ ID NO: 31 and FIG. 4). DNA sequencing using oligonucleotides given in Table 3 confirmed successful cloning of ispS, idi, and dxs without mutations (FIG. 5). The ispS and idi genes are as described in example 1 and 2 respectively.

TABLE 3Oligo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
temperatureaaaaaaaaaa
pressureaaaaaaaaaa
pressureaaaaaaaaaa
Login to View More

Abstract

The invention provides a method for producing a terpene or a precursor thereof by microbial fermentation. Typically, the method involves culturing a recombinant bacterium in the presence of a gaseous substrate whereby the bacterium produces a terpene or a precursor thereof, such as mevalonic acid, isopentenyl pyrophosphate, dimethylallyl pyrophosphate, isoprene, geranyl pyrophosphate, farnesyl pyrophosphate, and / or farnesene. The bacterium may comprise one or more exogenous enzymes, such as enzymes in mevalonate, DXS, or terpene biosynthesis pathways.

Description

CROSS REFERENCE TO RELATED APPLICATIONS[0001]This application is a continuation of U.S. patent application Ser. No. 13 / 909,012 filed Jun. 3, 2013, which claims the benefit of U.S. Provisional Patent Application 61 / 654,412 filed Jun. 1, 2012, the entirety of which are incorporated herein by reference.SEQUENCE LISTING[0002]This application includes a nucleotide / amino acid sequence listing submitted concurrently herewith and identified as follows: 278,490 byte ASCII (text) file named “LT079US2_ST25.txt” created on Mar. 5, 2015 the entirety of which is incorporated herein by reference.FIELD OF THE INVENTION[0003]The present invention relates to recombinant microorganisms and methods for the production of terpenes and / or precursors thereof by microbial fermentation of a substrate comprising CO.BACKGROUND OF THE INVENTION[0004]Terpenes are a diverse class of naturally occurring chemicals composed of five-carbon isoprene units. Terpene derivatives include terpenoids (also known as isopreno...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12P5/00C12P9/00C12P7/42
CPCC12P5/007C12P9/00C12P7/42C12Y101/01267C12Y401/01033C12Y402/03027C12Y406/01012C12Y503/03002C12Y101/01088C12Y202/01007C12Y203/01009C12Y203/0301C12Y205/0101C12Y207/01036C12Y207/04002C12N15/52C12Y117/07001C12Y205/0109C12Y207/01148C12Y207/0706C12Y402/03046C12N9/88C12N9/1025C12N9/1205C12N9/1022C12N9/1229C12N9/1029C12N9/0006C12N9/1085Y02E50/30Y02A50/30C12N15/74
Inventor CHEN, WENDY YITINGLIEW, FUNGMINKOEPKE, MICHAEL
Owner LANZATECH NZ INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com