Gene engineering bacterium, preparation and use thereof

A genetically engineered bacteria and gene technology, applied in the field of bioengineering, can solve the problems of protein without enzymatic activity, type I diabetes immune activity, unrealistic human GAD65 protein, and low expression of human GAD65, so as to avoid high price and production cost The effect of low cost and easy purification

Inactive Publication Date: 2007-10-17
EAST CHINA NORMAL UNIV
View PDF0 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, it is unrealistic to obtain a large amount of human GAD65 protein by means of isolation and purification from natural tissues and artificial chemical synthesis
Foreign researchers have tried to express natural recombinant human GAD65 in expression systems such as rabbit reticulocytes, yeast cells, insect cells, and Escherichia coli, but found the following shortcomings: (1) the expression level of human GAD65 is very low, and The GAD65-Ab detection method requires high equipment and can only be used for laboratory analysis; (2) The expression of human GAD65 is mainly expressed in the form of inclusion bodies, and it is difficult to perform correct renaturation, resulting in no enzymatic activity and specific targeting of the protein Immune activity of type I diabetes; (3) time-consuming, labor-intensive and costly, not suitable for China's national conditions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene engineering bacterium, preparation and use thereof
  • Gene engineering bacterium, preparation and use thereof
  • Gene engineering bacterium, preparation and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1: the preparation of genetically engineered bacteria

[0050] Step 1 Primer Design

[0051] According to the known cDNA sequence of human GAD65, specific Nest-PCR upstream primers A1, A2 and downstream primer B1 were designed, wherein KpnI restriction endonuclease and enterokinase cleavage sites were introduced into the upstream primer A2, and downstream A BamHI restriction endonuclease cutting site was introduced into primer B1.

[0052] Upstream primer A1:

[0053] 5'-GCGACCTGCTCCAGTCTCCAAAAG-3'

[0054] Upstream primer A2:

[0055] 5'-TTA GGTACCGACGACGACGACAAG GCATCTCCGGGCTCT-3'

[0056] KpnI enterokinase cleavage site

[0057] Downstream primer B1:

[0058] 5'-GCT GGATCC TGGAACAGCTTGGTGAGCA-3'

[0059] BamHI

[0060] The second step Nest-PCR amplification of human GAD65DNA fragment

[0061] Using the human pancreas cDNA library (purchased from Clontech) as a template, high-fidelity Pfu DNA polymerase was used to amplify GAD65,...

Embodiment 2

[0066] Example 2 Preparation of Thioredoxin-Human Glutamic Acid Decarboxylase 65 Fusion Protein Using the Genetically Engineered Bacteria of the Present Invention

[0067] An application of a genetically engineered bacterium highly expressing human glutamic acid decarboxylase 65, that is, using the genetically engineered bacterium to produce human glutamic acid decarboxylase 65. The following affinity chromatography medium is Ni-NTA His.Bind or His.Bind resin, purchased from Novagen, and the following enterokinase is purchased from MERCK.

[0068] The first step liquid culture

[0069] The genetically engineered bacteria constructed in Example 1 were inoculated into 20 mL of LB liquid medium containing 100 mg / mL Amp, cultivated at 37°C, 210rpm to OD600=0.6-1.0. Centrifuged at 5000rpm, 4°C for 5min, and collected the precipitated Bacteria were stored overnight at 4°C. The next day, 20 mL of LB medium containing 100 mg / mL Amp was used to resuspend the bacteria, and 4% volume w...

Embodiment 3

[0072] Embodiment 3 Utilizes the genetically engineered bacteria of the present invention to prepare human glutamic acid decarboxylase 65

[0073] Human glutamic acid decarboxylase 65 was prepared on the basis of the second step in Example 3. The fusion protein TrxA-GAD65 was digested with enterokinase. Add 1 unit of enterokinase per mg of fusion protein, shake at 25°C, and digest for about 16 hours. Digested products were separated by affinity chromatography Ni-NTA His.Bind or His.Bind resin. The breakthrough peak and the elution peak of NTA / IDA-0 were collected. The two fractions were combined and GAD65 was desalted and concentrated using 5KD-10KD MilliporeAmicon Ultra-15 ultrafiltration tubes. Protein concentration was determined by the Lowry method.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a gene engineered bacteria, and its preparation method and uses, belongs to biological engineering field. The gene engineered bacteria is composed of plasmid and host bacteria in which host bacteria is any one of Ecoli DH5alpha,BL21(DE3) or Rosetta-gami(DE3), the recombinant plasmid is pET32a(+) containing gene GAD65. The construction method of engineered bacteria comprise: designing Nest-PCR upper-stream primer and down-stream primer, amplifying human GAD65 gene fragment using PCR from human pancreas cDNA library, transforming Ecoli via vector and obtaining highly effective expression recombinant human GAD65 gene engineered bacteria. The inventive engineered bacteria can be used to produce soluble active thioredoxin- human Glutamic Decarboxylase 65 fusion protein and active recombinant human GAD65 which has enzymatic activity and immunological activity and are easy to purify. The expression volume is high and cost is low .

Description

technical field [0001] The invention relates to a genetically engineered bacterium, in particular to a genetically engineered bacterium capable of efficiently expressing human glutamic acid decarboxylase 65 or thioredoxin-human glutamic acid decarboxylase 65 fusion protein, and the preparation of the genetically engineered bacterium The method and application thereof belong to the technical field of bioengineering. Background technique [0002] Diabetes is a serious worldwide disease with a high incidence rate. At present, the total number of diabetic patients in the world is nearly 200 million. In this huge diabetic crowd, about 10% are type I diabetic patients, and most of them are young people. The remaining 90% of the type II diabetes population also has a part of adults with latent autoimmune diabetes (LADA), and these patients have a tendency to change from type II diabetes to type I diabetes. It is helpful for patients to carry out early in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12N15/66C12P21/02C12N15/62C07K19/00C12N9/00C12N15/52
Inventor马明浩吴自荣黄静胡荣章叶海峰金丽
OwnerEAST CHINA NORMAL UNIV