Cultivated silkworm glutathione-S-transferase BmGSTe5 gene
A technology of glutathione and transferase, applied in the direction of transferase, genetic engineering, plant genetic improvement, etc., can solve the problem that there is no pesticide resistance or antioxidant activity of silkworm.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0039]Search the Bombyx mori Expressed sequence tag (EST) database with the coding region sequence (Coding sequence, CDS) of the BmGSTe5 gene to find EST evidence for the BmGSTe5 gene, and then design gene-specific primers after splicing the CDS and EST sequences ; Forward primer of BmGSTe5: 5'TTCCGACTATGGTGTTCATCCTGTA 3', reverse primer: 5'TTGTATAATACCGGTTCAGCAGTGG 3'; using the designed specific primers to amplify the cDNA in the 5th instar 3 of the silkworm as a template, and obtain the target band, PCR After recovery, the product was ligated with the pMD18-T vector, transformed into DH5α competent cells, and sent to Shanghai Sangon for sequencing after obtaining positive clones. The sequencing results showed that the amplified sequence was consistent with the expected result; the target fragment was combined with pET28a, and T4 ligase Ligate and transform B121(DE3) competent cells, screen to obtain clones containing pET28a-BmGSTe7, and culture single clones containing pET28...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 