Fusion protein penetrating blood-brain barrier with nerve nourishment gene and encoding gene and uses thereof

A neurotrophic factor and fusion protein technology, which is applied in the field of neurotrophic factor fusion protein, can solve the problems of bringing into the brain parenchyma, unstable conjugates, low yield of fusion protein, etc., and achieve the effect of exerting biological activity

Inactive Publication Date: 2008-04-09
ZHUJIANG HOSPITAL SOUTHERN MEDICAL UNIV
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Aiming at the shortcomings of the prior art, the present invention provides a neurotrophic factor fusion protein and a preparation method and use of its nucleotide sequence, which solves the problems of unstable conjugates, low yield of fusion protein, and hyperosmotic solution that is easily absorbed into the blood. The problem of bringing toxic components into the brain parenchyma

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein penetrating blood-brain barrier with nerve nourishment gene and encoding gene and uses thereof
  • Fusion protein penetrating blood-brain barrier with nerve nourishment gene and encoding gene and uses thereof
  • Fusion protein penetrating blood-brain barrier with nerve nourishment gene and encoding gene and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1: Design of BDNF-PTD / Antp fusion protein structure

[0049]Please refer to Figure 1, ATG is the nucleotide encoding methionine, PTD is the protein transduction domain, NTs is the nucleotide sequence of the human neurotrophic factor family member encoding the mature domain protein, and TER is the termination codon of the nucleic acid. Methionine was added before the maturation region of BDNF, PTD / Antp was located at the C-terminal of BDNF, and it was connected with BDNF through the spacer amino acid glutamic acid to obtain the structure of BDNF-PTD / Antp fusion protein.

Embodiment 2

[0050] Example 2: Amplification of BDNF-PTD / Antp fusion protein gene and construction of prokaryotic expression vector

[0051] According to the nucleotide sequence of the coding BDNF mature region protein reported by the gene bank, and the structure of the above-mentioned BDNF-PTD / Antp fusion protein, the primers for amplifying the BDNF-PTD / Antp fusion protein gene are designed as follows:

[0052] Primer I is shown in SEQ ID NO: 3:

[0053] 5'GC CATATG CACTCTGACCCTGCCCGCCGA-3' (NdeI site is underlined)

[0054] Primer II is shown in SEQ ID NO: 4:

[0055] 5'-GC CTCGAG CTAGCATTTTTCCACTTCATCCTCCTGTTTTGGAATTGGAACCAGATTT

[0056] GTCTGCCGGATCCCCTTTTAATGGTCAATGTACATAC-3' (XhoI site is underlined)

[0057] Using the PCR method, the BDNF-PTD / Antp gene was amplified using the plasmid popeMPBDNF (ATCC, USA) containing the full-length cDNA of human BDNF as a template. The PCR reaction parameters were: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 45 sec, annealin...

Embodiment 3

[0058] Example 3: Induced expression of BDNF-PTD / Antp fusion protein

[0059] Transform the competent expression strain BL21(DE3)plys with the correct pBDNF-PTD / Antp recombinant plasmid analyzed by enzyme digestion and nucleic acid sequencing, and spread it on a plate containing 50 mg / mL kanamycin and 34 mg / mL chloramphenicol. Pick a single positive clone at random, inoculate into 200mL LB medium test tubes containing kanamycin (50mg / mL) and chloramphenicol (34mg / mL), cultivate overnight at 37°C, and transfer to 1000mL containing the same Continue to culture in LB medium with antibiotics for 1 hour, to OD 600 When = 0.6, add IPTG to a final concentration of 0.1 mmol / L, induce culture for 5 hours, centrifuge at 5000 rpm for 15 min at 4°C, and discard the supernatant to collect the bacteria.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a clone of a neurotrophic factor fusion protein gene containing a protein transduction domain, the expression and the purification of the protein, the biological activity of the fusion protein, and the effect for penetrating a cell membrane, particularly for the blood-brain barrier in vivo. The fusion protein comprises a first area which has at least 75 percent of a homologous sequence with a neurotrophic factor and a second area which has at least 75 percent of a homologous sequence with an amino acid sequence of the protein transduction domain, and the second area is positioned at a carboxyl-terminal of the first area; the present invention can carry out the replacement, deletion or addition of the amino acid residues under the premise of not changing the characteristics of the fusion protein. The fusion protein can be used as a drug for the treatment of a plurality of neurodegenerative disorders in central nervous system and the peripheral neuropathies by peripheral routes for drug delivery.

Description

technical field [0001] The present invention relates to a neurotrophic factor fusion protein, in particular to the preparation of the neurotrophic factor fusion protein containing a protein transduction domain, its coding nucleotide sequence, its expression vector, host cell, and its use. Background technique [0002] Neurotrophic factors (neurotrophins, NTs) refer to a class of protein factors produced by the body that can promote the survival, growth and differentiation of nerve cells, and are a family of low molecular weight proteins. During the development of the nervous system, those cells that have obtained sufficient neurotrophic effects survive, while others die naturally, and the death of nerve cells occurs with the development of the nervous system. The unnatural death of nerve cells (such as some degenerative neuropathies) can be alleviated by obtaining external neurotrophic factors. Neurotrophic factors have become one of the most exciting research hotspots in t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62A61K38/16
Inventor季爱民车瓯马蕾蕾苏丹马翰章李晓东孙靓王秉钧张忠义
OwnerZHUJIANG HOSPITAL SOUTHERN MEDICAL UNIV