Armoured RNA and method for producing the same
A technology of nucleotide sequence and envelope protein, applied in the field of armored RNA and its preparation, can solve the problems of low stability and poor safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Construction of armored RNA expression platform:
[0059] 1. Construction of expression vector
[0060] Using the pMS27 plasmid as a template, use MS2F (5'ATGGATCCTCCTGCTCAACTTCCTGTCG3', SEQ ID No.5), MS2R1 (5'GCAAGCTTTCTTCGACATGGGTAATCCT3', SEQ ID No.6), MS2F, MS2R2 (5'GCAAGCTTTTAGTAGATGCCGGAGTTT3', SEQ ID No.7) as Primers were used to amplify, and the target bands were 1750bp (SEQ ID No.3) and 1707bp (SEQ ID No.4). After tapping and purifying, they were connected to pGEM-Teasy vector, extracted plasmids, and double-digested with BamHI and HindIII At the same time, the pET30b plasmid was double-digested and recovered by tapping the rubber. The two target fragments were respectively connected to the expression vector pET30b. The resulting recombinant plasmids were named pAR-1 and pAR-2, respectively, and were verified by PCR and enzyme digestion and sent to Shanghai Sangong for sequencing verification. .
[0061] 2. Expression and identification of armored RNA
[006...
Embodiment 2
[0121] Construction of armored RNA expression platform:
[0122] Operation is with embodiment 1.
[0123] Preparation of armored RNA containing influenza A type 3 M gene RNA:
[0124] Extract the RNA of Influenza A / Hangzhou / 189 / 2005 (H3N2) strain as a template, and use M-petF(5'CTC AAGCTT GAAGGTAGATATTGAAAGATG3'SEQ ID NO.16), M-petR (5'CAT AAGCTT GAAACAAGGTAGTTTTTTACTC3'SEQ ID NO.17) was used as primer to amplify the long fragment of M gene by RT-PCR. The underlined part of the primer is the HindIII restriction site. The RT-PCR parameters were as follows: cDNA was synthesized at 50°C for 30 minutes, followed by 30 cycles at 94°C for 10 s, 56°C for 10 s, and 72°C for 1 min 15 s. The construction and expression of expression vectors are the same as in Example 1. Prepare the armored RNA of the ribonuclease-resistant ribonuclease-resistant RNA containing the conserved region 1016bp RNA (SEQ ID NO.2) of the M gene of type A 3 influenza virus, which contains the nucleotide se...
Embodiment 3
[0139] Example 3 Application of Armored RNA in Virus Detection
[0140] Armored RNA can be used as a stable standard and quality control without the risk of biological infection.
[0141] Armored RNA is a phage-like particle assembled from viral RNA wrapped by MS2 envelope protein. It has a good similarity with viruses and can be directly used as a positive control in the detection of viral nucleic acids. It can be used for RT-PCR detection kits and network experiments. Laboratory training provides samples that are stable and non-biologically infectious. Add armored RNA to serum or PBS or saline, use Qiagen virus RNA extraction kit to extract RNA, and perform RT-PCR, which can control the quality of the whole process of the experiment, including RNA extraction efficiency, reverse transcription efficiency, reagent quality and Random errors during operation, etc.
[0142] In the quantification of RNA viruses, armored RNA can be used as an internal reference for detection, and ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| correlation coefficient | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
