Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Armoured RNA and method for producing the same

A technology of nucleotide sequence and envelope protein, applied in the field of armored RNA and its preparation, can solve the problems of low stability and poor safety

Inactive Publication Date: 2008-05-07
杭州市疾病预防控制中心
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In order to solve the problems of poor safety and low stability in existing virus detection, the invention provides a kind of armored RNA, and the invention also provides a preparation method of the armored RNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Armoured RNA and method for producing the same
  • Armoured RNA and method for producing the same
  • Armoured RNA and method for producing the same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Construction of armored RNA expression platform:

[0059] 1. Construction of expression vector

[0060] Using the pMS27 plasmid as a template, use MS2F (5'ATGGATCCTCCTGCTCAACTTCCTGTCG3', SEQ ID No.5), MS2R1 (5'GCAAGCTTTCTTCGACATGGGTAATCCT3', SEQ ID No.6), MS2F, MS2R2 (5'GCAAGCTTTTAGTAGATGCCGGAGTTT3', SEQ ID No.7) as Primers were used to amplify, and the target bands were 1750bp (SEQ ID No.3) and 1707bp (SEQ ID No.4). After tapping and purifying, they were connected to pGEM-Teasy vector, extracted plasmids, and double-digested with BamHI and HindIII At the same time, the pET30b plasmid was double-digested and recovered by tapping the rubber. The two target fragments were respectively connected to the expression vector pET30b. The resulting recombinant plasmids were named pAR-1 and pAR-2, respectively, and were verified by PCR and enzyme digestion and sent to Shanghai Sangong for sequencing verification. .

[0061] 2. Expression and identification of armored RNA

[006...

Embodiment 2

[0121] Construction of armored RNA expression platform:

[0122] Operation is with embodiment 1.

[0123] Preparation of armored RNA containing influenza A type 3 M gene RNA:

[0124] Extract the RNA of Influenza A / Hangzhou / 189 / 2005 (H3N2) strain as a template, and use M-petF(5'CTC AAGCTT GAAGGTAGATATTGAAAGATG3'SEQ ID NO.16), M-petR (5'CAT AAGCTT GAAACAAGGTAGTTTTTTACTC3'SEQ ID NO.17) was used as primer to amplify the long fragment of M gene by RT-PCR. The underlined part of the primer is the HindIII restriction site. The RT-PCR parameters were as follows: cDNA was synthesized at 50°C for 30 minutes, followed by 30 cycles at 94°C for 10 s, 56°C for 10 s, and 72°C for 1 min 15 s. The construction and expression of expression vectors are the same as in Example 1. Prepare the armored RNA of the ribonuclease-resistant ribonuclease-resistant RNA containing the conserved region 1016bp RNA (SEQ ID NO.2) of the M gene of type A 3 influenza virus, which contains the nucleotide se...

Embodiment 3

[0139] Example 3 Application of Armored RNA in Virus Detection

[0140] Armored RNA can be used as a stable standard and quality control without the risk of biological infection.

[0141] Armored RNA is a phage-like particle assembled from viral RNA wrapped by MS2 envelope protein. It has a good similarity with viruses and can be directly used as a positive control in the detection of viral nucleic acids. It can be used for RT-PCR detection kits and network experiments. Laboratory training provides samples that are stable and non-biologically infectious. Add armored RNA to serum or PBS or saline, use Qiagen virus RNA extraction kit to extract RNA, and perform RT-PCR, which can control the quality of the whole process of the experiment, including RNA extraction efficiency, reverse transcription efficiency, reagent quality and Random errors during operation, etc.

[0142] In the quantification of RNA viruses, armored RNA can be used as an internal reference for detection, and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
correlation coefficientaaaaaaaaaa
Login to View More

Abstract

The invention relates to an armored RNA and a preparation method of the armored RNA, which is characterized in that the armored RNA is a RNA enwrapped by MS2 envelope protein. The invention also discloses the preparation method of the armored RNA. The armored RNA contains a plurality of virus RNA segments, and the armored RNA contains the negative or positive strand virus RNA, which provides the nucleic acid detection of multiplex viruses with safe and stable standard materials and quality control materials.

Description

technical field [0001] The invention relates to an armored RNA and a preparation method thereof. Background technique [0002] RNA viral infectious diseases have the characteristics of universality, adaptability, viciousness, stubbornness and difficulty of prevention, etc., which often cause tens of millions of people to lose their lives and cause huge economic losses. The influenza pandemic in the 1950s and the serious epidemic caused by SARS in 2003, every time these sudden public health events occur, will have a serious negative impact on economic and social stability. According to the World Health Organization, the threat of bird flu to Asia may be more serious than SARS. In virus detection and gene expression research, RT-PCR is often required for quantitative or qualitative purposes, which requires RNA quality controls and standards. [0003] In order to better monitor infectious diseases, various network laboratories have been established in various countries and ev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/01C12N15/11C12N15/10C12Q1/68C12Q1/70
Inventor 于新芬潘劲草叶榕寇宇黄志成
Owner 杭州市疾病预防控制中心
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com