Barley yellow dwarf virus interference virogene expression vector and its construction method and application
A technology of barley yellow dwarf virus and expression vector, which is applied in the field of genetic engineering and can solve the problems of RNA interference mediation that have not been reported.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Embodiment 1, the construction of barley yellow dwarf virus GAV interference virus gene expression vector
[0046] Step 1, according to the genome sequence of BYDV-GAV, the present invention first designs the primer of full-length CP gene, as follows:
[0047] SEQ NO 1: 5'ATGAATTCAGTAGGCCGTAGA 3'
[0048] SEQ NO 2: 5' CTATTTGGGAGTCATGTTGGC 3'
[0049] Using the total RNA of BYDV-GAV as a template, the full-length CP gene fragment (600bp) was amplified by RT-PCR (Figure 1). The target fragment was recovered and then connected to the pGEM T-easy vector, transformed into E. coli JM110, and cloned and sequenced for identification. , a positive clone of CP gene was obtained.
[0050] Step 2, the acquisition of the precursor double-stranded CP gene positive plasmid containing RNA interference
[0051] According to the mechanism of RNA interference, the present invention designs RNA interference primers with four enzyme cleavage sites (AscI, AvrII, SpeI, SgfI) full-length C...
Embodiment 2
[0057] Example 2 Acquisition and detection of transgenic plants
[0058] Step 1. Take the constructed interference vector and its control vector, respectively transform JM1 10 competent cells, plate them, and culture at 37°C overnight. Pick a single colony, shake and cultivate a small amount of liquid LB (3-5ml); after medium-volume culture (20-30ml); inoculate 200ml of liquid LB medium at a ratio of 1:50, and shake and cultivate at 37 ° C for 2-3 hours; Chloramphenicol with a final concentration of 170 μg / ml was added, and the culture was continued for 16-18 hours; the cells were collected by centrifugation at 5000 rpm for 10 minutes; the plasmid was purified by a large-scale plasmid extraction kit (Marligen). See the manufacturer's instructions for the method. The concentration of the obtained plasmid reaches 2-3 mg / ml, contains more than 90% supercoiled DNA, and can be used for gene gun transformation.
[0059] Step 2. The young ears of wheat (variety: Yangmai 158) that h...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com