Barley yellow dwarf virus interference virogene expression vector and its construction method and application

A technology of barley yellow dwarf virus and expression vector, which is applied in the field of genetic engineering and can solve the problems of RNA interference mediation that have not been reported.

Inactive Publication Date: 2008-07-09
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, RNA interference technology has been widely used in the study of plant virus gene function and pathogenic mechanism

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Barley yellow dwarf virus interference virogene expression vector and its construction method and application
  • Barley yellow dwarf virus interference virogene expression vector and its construction method and application
  • Barley yellow dwarf virus interference virogene expression vector and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1, the construction of barley yellow dwarf virus GAV interference virus gene expression vector

[0046] Step 1, according to the genome sequence of BYDV-GAV, the present invention first designs the primer of full-length CP gene, as follows:

[0047] SEQ NO 1: 5'ATGAATTCAGTAGGCCGTAGA 3'

[0048] SEQ NO 2: 5' CTATTTGGGAGTCATGTTGGC 3'

[0049] Using the total RNA of BYDV-GAV as a template, the full-length CP gene fragment (600bp) was amplified by RT-PCR (Figure 1). The target fragment was recovered and then connected to the pGEM T-easy vector, transformed into E. coli JM110, and cloned and sequenced for identification. , a positive clone of CP gene was obtained.

[0050] Step 2, the acquisition of the precursor double-stranded CP gene positive plasmid containing RNA interference

[0051] According to the mechanism of RNA interference, the present invention designs RNA interference primers with four enzyme cleavage sites (AscI, AvrII, SpeI, SgfI) full-length C...

Embodiment 2

[0057] Example 2 Acquisition and detection of transgenic plants

[0058] Step 1. Take the constructed interference vector and its control vector, respectively transform JM1 10 competent cells, plate them, and culture at 37°C overnight. Pick a single colony, shake and cultivate a small amount of liquid LB (3-5ml); after medium-volume culture (20-30ml); inoculate 200ml of liquid LB medium at a ratio of 1:50, and shake and cultivate at 37 ° C for 2-3 hours; Chloramphenicol with a final concentration of 170 μg / ml was added, and the culture was continued for 16-18 hours; the cells were collected by centrifugation at 5000 rpm for 10 minutes; the plasmid was purified by a large-scale plasmid extraction kit (Marligen). See the manufacturer's instructions for the method. The concentration of the obtained plasmid reaches 2-3 mg / ml, contains more than 90% supercoiled DNA, and can be used for gene gun transformation.

[0059] Step 2. The young ears of wheat (variety: Yangmai 158) that h...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to 'an expression vector of interfering viruses of barley yellow dwart viruses, a constructing method, and the application' and belongs to the technical field of biological engineering. The invention provides the expressing vector of interfering viruses of barley yellow dwart viruses which is characterized in that a skeleton carrier which is adopted is pMCG161, a sense strand of a coat protein gene of the barley yellow dwart viruses is inserted between two restriction sites of AscI and AvrII which are on the upstream portion of the pMCG161, and an antisense strand of the coat protein gene of the barley yellow dwart viruses is inserted between two restriction sites of SpeI and SgfI which are on the downstream portion of the pMCG161. The expression vector of interfering viruses of barley yellow dwart viruses GAV which is constructed by the invention is transferred into wheat through particle bombardment to obtain a transgene wheat variety which has resistance to the barley yellow dwart viruses GAV. The invention provides a breeding way with high efficiency and a new strategy.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to a barley yellow dwarf virus interference virus gene expression vector and a construction method and application thereof. It further relates to a barley yellow dwarf virus GAV virus gene expression vector, and a method for transforming the grass plant wheat and obtaining resistant plants. Background technique [0002] Wheat yellow dwarf disease, caused by Barley yellow dwarfvirus (BYDV), is one of the most common and devastating viral diseases of cereal crops. The disease mainly harms wheat. Since BYDV was first discovered in wheat in Shaanxi and Gansu in 1960, the disease has been reported every year in winter and spring wheat areas in nearly 20 provinces, municipalities and autonomous regions in Northwest my country, North China, Southwest China and East China. There are different degrees of harm. Among them, western Henan, southern Shanxi, Guanzhong, Longdong, east...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/63C12N15/40A01H1/00
Inventor 王锡锋吴蓓蕾刘艳周广和
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap