Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice HAP3 and application of the same in improving stress tolerance of plants

A gene and plant technology, applied in the application field of rice HAP3 and its gene in improving plant stress tolerance, to achieve the effects of improving stress tolerance, improving tolerance, and enhancing salt resistance

Active Publication Date: 2008-07-16
FRONTIER LAB OF SYST CROP DESIGN CO LTD
View PDF0 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no literature reporting that rice HAP genes are related to the regulation of stress tolerance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice HAP3 and application of the same in improving stress tolerance of plants
  • Rice HAP3 and application of the same in improving stress tolerance of plants
  • Rice HAP3 and application of the same in improving stress tolerance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1. Acquisition of genes encoding HAP transcription factors related to stress tolerance in rice

[0038] 1. Acquisition of gene sequence

[0039] OsHAP3A (GenBank No.: AB095438), OsHAP3B (GenBank No.: AB095439), and OsHAP3C (GenBank No.: AB095440) were queried from NCBI. (Miyoshi K, Ito Y, Serizawa A, Kurata N. OsHAP3 genes regulate chloroplast biogenesis in rice. The Plant Journal (2003) 36:532-540).

[0040] 2. PCR amplification and sequence analysis of OsHAP3A, OsHAP3B and OsHAP3C

[0041] Primers were designed according to the sequence in GenBank, and the cDNA of Oryza sativa "Zhonghua NO.11" was used as a template to amplify OsHAP3A, OsHAP3B and OsHAP3C by RT-PCR. The primer sequences are as follows:

[0042] (1) Design primers according to the CDS sequence of OsHAP3A:

[0043] OsHAP3A primer sequence:

[0044] Forward primer: 5'>CACCATGATGATGATGGATCTAGGGTTT>3'

[0045] Reverse primer: 5'>GGTGTCCCCATTATGATACTGAG>3'

[0046] (2) Design primers according...

Embodiment 2

[0057] Example 2. Acquisition of transgenic rice with genes encoding HAP transcription factors related to stress tolerance

[0058] The HAP transcription factor coding genes OsHAP3A, OsHAP3B and OsHAP3C related to stress tolerance obtained in Example 1 were transformed into rice by the Agrobacterium-mediated method, and the specific methods were as follows:

[0059] 1) Construction and identification of transformation vector

[0060] Artificially synthesized 182bp fragment containing endonuclease sites such as Sac I, Hind III and Spe I, which has the nucleotide sequence of SEQ ID NO: 7 in the sequence table, and the fragment is inserted after double digestion with Sac I and Spe I The pH2GW7 vector (purchased from inVitrogen) was used to obtain an intermediate vector containing a Hind III restriction site, which was named pHUG-1. After enzyme digestion and sequencing identification, it was proved that the inserted fragment was correct, and the construction of pHUG-1 was correc...

Embodiment 4

[0068] Embodiment 4, transgenic T 1 Drought Tolerance Identification of Progeny Plants

[0069] Harvest OsHAP3A, OsHAP3B and OsHAP3C T 1 Genetically modified rice seeds. Soak the seeds in water for 3 days to germinate them, then use 50 mg / L hygromycin for resistance screening, and use non-transgenic rice Zhonghua 11 as a control. After 5 days of screening, all the control plants died, and counted the resistant seedlings and dead seedlings of the transgenic plants To analyze the resistance segregation ratio of the transgenic plants, select the lines with a segregation ratio of about 3:1 between resistant seedlings and non-resistant seedlings. The results showed that OsHAP3A, OsHAP3B and OsHAP3C transgenic lines with single-site insertions were obtained. After continuing to cultivate for one week, drought treatment was carried out, and non-transgenic rice Zhonghua 11 plants were set as a control. Paddy rice seedling is planted in the soil of boxing, adopts vermiculite: the mi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a group of HAP3 genes which are derived from rice and are related with stress tolerance, the encoded protein has one of the following amino acid sequences: 1) the SEQ ID No:1, 3 or 5 in a sequence table; 2) the amino acid residue sequence of the SEQ ID No.:1, 3 or 5 in the sequence table is treated with the substitutes, deletes or adds of one to ten amino acid residues and the derived protein has the effect of regulating the performance of plant stress tolerance. The experiments proves that the transgenic rice of the invention can improve the tolerance of the rice to the high-salt, drought and low-temperature adversity threats and have no apparent impacts on the normal growth and the economic traits of the rice. The protein and the encoded genes of the invention have important theoretical and practical significances on the research of a plant stress tolerance mechanism, the improvement of the plant stress tolerance and the improvement of the related traits, thereby playing an important role in the stress tolerance genetic engineering improvement of plants (particularly cereal crops) and having broad application prospect.

Description

technical field [0001] The invention relates to stress-related transcription factors in plants and their coding genes and applications, in particular to HAP transcription factors and their coding genes derived from rice related to stress tolerance and their application in improving plant stress tolerance. Background technique [0002] Transcription factors are DNA-binding proteins that can specifically interact with cis-acting elements in the promoter region of eukaryotic genes or related proteins that can interact with these proteins, and can specifically activate or repress transcription Key factors (Guilfoyle T J. 1997. The structure of plant gene promoters. Genet Engin, 19: 15-47). The differentiation of cells, the morphological development of multicellular organisms, the establishment of organs, and the response to external stimuli (biological and abiotic stress) are closely related to the role of transcription factors (Adam E, Szell M, Szekeres M, et al.1994. The deve...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C12N15/65C07K14/415A01H1/00
Inventor 王喜萍
Owner FRONTIER LAB OF SYST CROP DESIGN CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com