Preparation and detection method of Bacterium typhosum rapid detection reagent kit

Abstract

The invention relates to a method for fast detecting bacteria specimen by loop mediate disothermal amplification technology (LAMP), particularly to a method for preparing a reagent kit for fast detecting salmonella typhosa and a method for detecting Salmonella typhosa. The reagent kit contains loop mediate disothermal amplification reaction liquid, Bst DNA polymerase and developer; the loop mediate disothermal amplification reaction liquid includes reaction buffer liquid, dNTP, bitter salt, upstream inner primer 5- TTACGTCACCAACGAC ACGGGACGTATTGGGCAATGACTGG-3, downstream inner primer 5- CGGTAAATACCATCCCCACGGCT AACGCAGCGAGAATGGC -3, upstream outer primer 5- GTCGCGTACTTTACGCCAT-3, downstream outer primer 5- ACCCTGACCATCCACCAG -3 and lycine; the method for detecting Salmonella typhosa comprises the steps of extracting bacterial DNA, loop mediate disothermal amplifying of the salmonella typhosa, and development detecting. The invention has the following advantages, including high speed, strong specificity, high sensitivity and low cost.

Description

technical field [0001] The invention relates to a method for rapid detection of bacterial samples using a loop-mediated isothermal amplification (LAMP) technology, in particular to a preparation and detection method of a rapid detection kit for Salmonella typhi. Background technique [0002] Salmonella enterica is a kind of non-spore-forming Gram-negative bacilli with a size of 0.6~1.0×2~3um. It is a genus of pathogenic intestinal bacteria, including typhoid bacteria, which generally have flagella and no capsule Most of them have pili, which are very similar to E. coli in shape and physiology. In 1885, Salmonella and others isolated Salmonella choleraesuis during the epidemic of cholera, so it was named Salmonella. Some Salmonella are pathogenic to humans, some are only pathogenic to animals, and some are pathogenic to both humans and animals. Salmonellosis is a general term for different forms of humans, domestic animals and wild animals caused by various types of Salmonel...

AI Technical Summary

Problems solved by technology

People have made unremitting efforts in the process of exploring Salmonella detection methods. The existing detection methods mainly include: 1. Isotope labeling. This method uses isotope-labeled Salmonella typhi DNA fragments. The sensitivity is high, but it takes a long time. At present, there is no report on the kit and detection method for the detection of Salmonella typhi by the loop-mediated isothermal amplification method