Reagent kit for sifting carrier of bovine uridine monophosphate ribozyme deletion disease
The technology of a buridylic acid kit, which is applied in the field of kits for screening carriers of buridylic acid ribozyme deficiency, can solve problems such as poor conservation of connecting peptides, and achieve the effect of reducing workload and improving accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1. Preparation of a kit for screening bovine ribonuclease deficiency carriers and its effect verification
[0034] 1. Preparation of a kit for screening the carriers of bovine uricase deficiency
[0035] The kit for screening bovine ribonuclease deficiency carriers of the present invention includes PCR reaction reagents, agarose gel electrophoresis reagents and enzyme digestion reagents. Their specific composition is as follows:
[0036] PCR primers: according to the sequence of the bovine UMPS gene in the GenBank database (GenBank Accession Number is X65125), at the 55th position of exon 5 of the UMPS gene (ie GenBank Accession Number is the 1247th nucleotide from the 5' end of X65125) Design primers on both sides of the point mutation (the disappearance of an AvaI restriction site), wherein the sequence of the forward primer (primer I) is: 5'GAACATTCTGAATTTGTGATTGGT3' (sequence 1 in the sequence table, this primer is synthesized by Shanghai Sangon Biotechnolo...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com