Supercharge Your Innovation With Domain-Expert AI Agents!

Reagent kit for sifting carrier of bovine uridine monophosphate ribozyme deletion disease

The technology of a buridylic acid kit, which is applied in the field of kits for screening carriers of buridylic acid ribozyme deficiency, can solve problems such as poor conservation of connecting peptides, and achieve the effect of reducing workload and improving accuracy

Inactive Publication Date: 2008-09-24
CHINA AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

By comparing the bovine UMPS gene with human and Dictyostelium discoideum (Dictyostelium) sequences, it was found that the possible region of the catalytic active center was highly conserved (Michel Jacquet et al, 1988, Sequence analysis of the DdPYR5-6gene coding for UMP synthase in Dictyostelium discoideum and comparison with orotate phosphoribosyl transferases and OMP decarboxylases, Mol. Gen Genet, 1988, 211: 441-445), but the middle region belonging to the connecting peptide is poorly conserved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent kit for sifting carrier of bovine uridine monophosphate ribozyme deletion disease
  • Reagent kit for sifting carrier of bovine uridine monophosphate ribozyme deletion disease
  • Reagent kit for sifting carrier of bovine uridine monophosphate ribozyme deletion disease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1. Preparation of a kit for screening bovine ribonuclease deficiency carriers and its effect verification

[0034] 1. Preparation of a kit for screening the carriers of bovine uricase deficiency

[0035] The kit for screening bovine ribonuclease deficiency carriers of the present invention includes PCR reaction reagents, agarose gel electrophoresis reagents and enzyme digestion reagents. Their specific composition is as follows:

[0036] PCR primers: according to the sequence of the bovine UMPS gene in the GenBank database (GenBank Accession Number is X65125), at the 55th position of exon 5 of the UMPS gene (ie GenBank Accession Number is the 1247th nucleotide from the 5' end of X65125) Design primers on both sides of the point mutation (the disappearance of an AvaI restriction site), wherein the sequence of the forward primer (primer I) is: 5'GAACATTCTGAATTTGTGATTGGT3' (sequence 1 in the sequence table, this primer is synthesized by Shanghai Sangon Biotechnolo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a reagent box of screening the carrier of missing uridine monophosphate ribozyme of ox. The reagent box comprises a PCR primer pair and an endonuclease AvaI. The PCR primer pair comprises a primer pair comprising a deoxyribonucleotide with the sequence 1 in the sequence table and a deoxyribonucleotide with the sequence 2 in the sequence table. In the detection method of DUMPS heterozygote on herb based on genome DNA, the PCR-RFLP method is utilized to directly classify the genotype of Holstein cow, the method is not affected by animal age, sex and gene expression time, no radioactivity is used, no collection of comparison sample is required, and not only the determination work is reduced, but also the determination accuracy is promoted. Using the method to screen the carrier of missing uridine monophosphate ribozyme does not need special instrument and is favorable for the requirement of the conventional laboratory detection.

Description

technical field [0001] The invention relates to a kit for screening bovine nuclease deficiency carriers. Background technique [0002] Holstein dairy cow is a dairy cow variety widely used all over the world. After a high degree of breeding and good feeding management, its production performance has been continuously improved, and it is playing an increasingly important role in human life. In recent years, due to the continuous selection of breeding and matching, the inbreeding between dairy cows has been increasing. At present, most of the Holstein cattle in the world can be traced back to a few particularly excellent breeding bulls in North America. In my country, a large number of imported breeding cattle, embryos and frozen semen increase the risk of rapid spread of genetic defects. Therefore, it is necessary to gradually establish a sound detection and prevention and control system. [0003] Genetic defects refer to structural or functional changes in the genetic mater...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 张沅孙东晓张松
Owner CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More