Expressing method of human interleukin 7 in eucaryon host
A technology of interleukin and host, applied in the direction of interleukin, cytokine/lymphokine/interferon, animal/human protein, etc., can solve the problems of reducing protein expression and biological activity, prokaryotic host expression toxicity, etc. , to achieve the effects of easy cultivation and fermentation, favorable biological activity and high yield of target protein
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0023] The X-33 Pichia pastoris strain used in the present invention and the integrative expression plasmid pPICZαB. vector were all purchased from Invritrogen Corporation of the United States.
[0024] 1. Clone the whole rhIL-7 gene:
[0025] A pair of primers were designed, and the cDNA obtained by reverse transcription of human bone marrow stromal cell mRNA was used as a template for PCR amplification. The conditions were: 94°C for 5 min, 94°C for 45 s, 58°C for 45 s, 72°C for 1 min, 30 cycles: 72°C for 10 min. The obtained amplified fragment was connected to the high-efficiency cloning vector pMD20-T (purchased from Guangzhou TaKaRa Company), and identified by PCR, enzyme digestion and nucleic acid sequencing. The determined sequence was consistent with the IL-7 sequence published by Genebank. The primer sequences are:
[0026] 5'GGCTCGAGATGTTCCATGTTTCTTTT Added XhoI restriction site
[0027] 3'AGTCTAGATCAGTGTTTCTTTAGTGCC Added XbaI restriction site
[0028] 2. Construc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 