Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Expressing method of human interleukin 7 in eucaryon host

A technology of interleukin and host, applied in the direction of interleukin, cytokine/lymphokine/interferon, animal/human protein, etc., can solve the problems of reducing protein expression and biological activity, prokaryotic host expression toxicity, etc. , to achieve the effects of easy cultivation and fermentation, favorable biological activity and high yield of target protein

Inactive Publication Date: 2008-11-12
GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI +1
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the main method of producing interleukins in the market is to express proteins in prokaryotic host E. coli, but on the one hand, the E. coli expression system is very easy to form incorrectly folded proteins and easy to form inclusion bodies, thereby reducing protein expression and biological activity. ; On the other hand, prokaryotic host expression may be toxic, so each expression product must be tested for toxicity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expressing method of human interleukin 7 in eucaryon host
  • Expressing method of human interleukin 7 in eucaryon host
  • Expressing method of human interleukin 7 in eucaryon host

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] The X-33 Pichia pastoris strain used in the present invention and the integrative expression plasmid pPICZαB. vector were all purchased from Invritrogen Corporation of the United States.

[0024] 1. Clone the whole rhIL-7 gene:

[0025] A pair of primers were designed, and the cDNA obtained by reverse transcription of human bone marrow stromal cell mRNA was used as a template for PCR amplification. The conditions were: 94°C for 5 min, 94°C for 45 s, 58°C for 45 s, 72°C for 1 min, 30 cycles: 72°C for 10 min. The obtained amplified fragment was connected to the high-efficiency cloning vector pMD20-T (purchased from Guangzhou TaKaRa Company), and identified by PCR, enzyme digestion and nucleic acid sequencing. The determined sequence was consistent with the IL-7 sequence published by Genebank. The primer sequences are:

[0026] 5'GGCTCGAGATGTTCCATGTTTCTTTT Added XhoI restriction site

[0027] 3'AGTCTAGATCAGTGTTTCTTTAGTGCC Added XbaI restriction site

[0028] 2. Construc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for expressing human interleukin 7 in eucaryotic host. When the eucaryotic host is pichia X-33, the method comprises the following steps of: (1) cloning an IL-7 gene of human; (2) building an eucaryotic expression vector; (3) transforming recombinant vector to the eucaryotic yeast host; and (4) expressing a rIL-7 protein in the yeast host. A prior method for expressing IL-7 by using prokaryotic host escherichia coli is changed, and a method for expressing IL-7 through eucaryotic host pichia is searched out, thereby ensuring an IL-7 biologic activity and obtaining a large amount of stable protein.

Description

technical field [0001] The present invention relates to the technology of applying recombinant DNA technology to produce genetically engineered protein medicine, in particular to a method for expressing human interleukin 7 (rhIL-7) in a eukaryotic host. Background technique [0002] Human interleukin 7 (human interleukin 7, rhIL-7) is an important member of the cytokine interleukin protein family, which is important for regulating the development and survival of lymphocytes. It was first discovered in 1988, when A.E.Namen et al. isolated this cytokine when studying the development of mouse B cells, and it has the function of stimulating the proliferation of mouse pre-B cells. Subsequent scientific studies have found that the number of T cells and B cells in the mice injected with IL-7 is greatly increased, and the development of the lymphatic system is abnormal in mice knocked out of IL-7 and its receptors, so IL-7 plays a very important role in the development of lymphatic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/24C12N15/81C07K14/54
Inventor 吴东海罗勇李侍武金守光许爱民
Owner GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products