Method for improving doramectin preparing bacterium with genome reorganization technique

A doramectin and gene technology, applied in the field of cell biology, can solve the problems of decreased yield of target protein, cumbersome steps and high cost

Inactive Publication Date: 2009-01-14
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The problems of using the above-mentioned traditional markers are that the operation is difficult, the steps are cumbersome, and the cost is high. So...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving doramectin preparing bacterium with genome reorganization technique
  • Method for improving doramectin preparing bacterium with genome reorganization technique
  • Method for improving doramectin preparing bacterium with genome reorganization technique

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0087] The present invention first establishes a new bacterial strain for preparing protoplast fusion-using marker plasmid to screen protoplast fusion. The method has the advantages of being easy to mark and remove the mark, and after removing the resistance mark, subsequent genetic manipulations, such as fusion again, can be conveniently performed. The method of the invention can be conveniently used for strain breeding and improvement based on gene shuffling technology, and has simple operation, low cost and low equipment requirement.

[0088] Based on the method for preparing a protoplast fusion strain, one or more protoplast fusion selections can be performed to obtain a strain with a certain excellent property (such as high doramectin production).

Embodiment 1

[0235] Construction of doramectin-producing bacteria by fusion

[0236] 1. The bkdF gene disruption strain of MMR78

[0237] The bkdF gene of MMR78 was interrupted by conventional PCR targeting technology, and the interrupted position was bases 5356308 to 5357522 on the chromosome of MMR78.

[0238] After interruption, this segment is replaced by the oriT+spc gene, the sequence of which is shown in SEQ ID NO:1.

[0239] The modified strain was obtained by using spc resistance selection, and the obtained strain was spc resistant.

[0240] 2. MMR78 olmA1 gene disruption strain

[0241] Using conventional PCR targeting technology, the olmA1 gene of MMR78 was interrupted, and the interrupted position was from base 3607909 to base 3626345 of MMR78 chromosome.

[0242] After interruption, this segment is replaced by oriT+apra gene, the sequence is as SEQ ID NO:2.

[0243] The modified strain was obtained by apra resistance selection, and the strain was apra resistant.

[0244] ...

Embodiment 2

[0251] Establishment of Protoplast Fusion Mutagenesis Method of Marker Plasmid

[0252] 1. Construction of marker vector pPFMtsr

[0253] Digest the pIJ702 plasmid (purchased from the Institute of Microbiology, Chinese Academy of Sciences) with endonuclease BclI to obtain the tsr-melC gene with BclI restriction sites at both ends, and clone it into the pSP72 plasmid digested with BglII (the same tail enzyme of BclI) Inside, the pQC156 plasmid containing tsr sites and the like was obtained.

[0254] Using the total chromosome of Streptomyces coelicolor A3 (2) (purchased from the Institute of Microbiology, Chinese Academy of Sciences) as a template, PCR amplification was performed with forward primer GAATTCGCAGCGTGAAGTAGTACC (SEQ ID NO: 7) and reverse primer GAATTCGGCCTCCTACTAGCGACC (SEQ ID NO: 8) , obtain the SCP2-oriC gene carrying EcoRI restriction sites at both ends, and clone it into the pQC156 plasmid that has been digested by EcoRI to obtain the pZR156 plasmid, which con...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for preparing strain which can generate protoplast fusion by using marked plasmid. The invention has the advantages that marks can be easily added and removed, thereby being convenient for performing breeding and improvement of the strain based on the gene shuffling technology. The invention also has the advantages that the operation is simple, the cost is low, the requirement for equipment is low, and the chromosome of the strain can not be damaged.

Description

technical field [0001] The invention belongs to the field of cell biology; more specifically, the invention relates to a method for preparing protoplast fusion strains, which can be used for breeding and improvement of various industrial strains (such as doramectin-producing bacteria). Background technique [0002] In industrial microbial breeding, protoplast mutagenesis and protoplast fusion techniques have been widely used and achieved good results. The mutagenesis fusion technology that combines the two has also been continuously applied and developed, especially the birth of Genome Shuffling technology, which has brought new ideas to the breeding of industrial microorganisms. [0003] In the general fusion of protoplasts, the selective genetic markers that can be identified on both parents are used to screen the fusions. However, the selectable markers traditionally used at present are mainly integration markers, drug resistance markers, auxotroph markers and the like. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/03
Inventor 覃重军胡敏杰夏海洋
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap