Quantitative detection method of gene rare mutation

A quantitative detection method and rare mutation technology, which is applied in the field of quantitative detection of rare mutations in genes, can solve the problems of low proportion of rare mutation sequences, inability to quantitatively analyze samples, cross-contamination between samples, etc., and achieve the effect of simple quantitative detection of mutations

Inactive Publication Date: 2012-04-18
XIAMEN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although PAP can be used for the detection of rare mutations, the detection mode of electrophoresis is destined to be unable to be used for the accurate quantification of mutations
[0010] The qualitative detection of mutations has the following disadvantages: (1) Because it cannot perform quantitative analysis and comparison of samples, and the proportion of rare mutation sequences is extremely low, when the concentration of the detection sample is too low, it may cause false positives due to the absence of mutant genes. negative test result
(2) Because of the inability to quantitatively analyze and compare samples, false positive test results may be generated due to spontaneous random mutations in the genome
[0012] Not only that, the qualitative detection of PAP using electrophoresis to analyze the results not only takes a long time and is labor-intensive, but also the post-processing of PCR products can easily lead to cross-contamination between samples, which is fatal for rare mutation detection of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quantitative detection method of gene rare mutation
  • Quantitative detection method of gene rare mutation
  • Quantitative detection method of gene rare mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Real-time fluorescent PAP quantitative detection of embodiment 1 human K-ras gene mutation

[0065] K-ras gene mutation is a broad-spectrum tumor marker. Currently, K-ras gene mutation detection methods are cumbersome and have poor selectivity. In this example, real-time quantitative PCR with PAP primers was used to detect the second nucleotide mutation in the twelfth codon of the first exon of the human K-ras gene, and the nucleic acid intercalating dye was used to indicate the amplification, to illustrate the effectiveness of the present invention for rare mutations Quantitative ability.

[0066] The mutant genome template was extracted from SW480 cultured cells (containing GGT->GTT mutation of codon 12 of the first exon of K-ras gene), and the wild-type genome template was extracted from 293T cultured cells. Prepare three sets of mixed templates for wild-type and mutant genomes:

[0067] 1. The total amount of template is 1ng / reaction system, and the proportion of ...

Embodiment 2

[0075] Example 2 Comparison of real-time fluorescent PAP quantitative detection and ARMS quantitative detection of human K-ras gene mutation.

[0076] In this example, real-time quantitative PCR with PAP primers and classical ARMS method were used to quantitatively detect the mutation of the second nucleotide in the twelfth codon of the first exon of the human K-ras gene, and the nucleic acid intercalating dye was used to indicate the amplification. To illustrate the quantitative ability of the present invention for rare mutations.

[0077] The mutant genome template was extracted from SW480 cultured cells (containing GGT->GTT mutation of codon 12 of the first exon of K-ras gene), and the wild-type genome template was extracted from 293T cultured cells. Two series of mixed templates of wild-type genome and mutant genome were prepared: the first series of mutant-type templates were diluted tenfold with water, as shown in Table 1. In the second series, the wild-type template wa...

Embodiment 3

[0087] Example 3 Comparison of real-time fluorescent PAP quantitative detection of rare mutations in clinical samples with other quantitative detection methods.

[0088] In this case, PAP primer real-time quantitative PCR, classical ARMS method and sequencing method were used to quantitatively detect the mutation of the second nucleotide in the twelfth codon of the first exon of the K-ras gene in the tumor tissues of 42 patients with colorectal cancer. The intercalating dye indicates the amplification situation, and the quantitative ability of the present invention for rare mutations in clinical samples is illustrated by comparing the three.

[0089] Primers are:

[0090] 12-2-T*forward: TGACTGAATAAACTTGTGGTAGTTGGAGCTG-ddT;

[0091] 12-2-T*reverse: GGCACTCTTTGCCTACGCCACA-ddA. The original primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. The 3' ends of the primers were blocked by the laboratory itself.

[0092] ARMS forward: ACTTGTGGTAGTTGGAGCTGT

[009...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a genetic detection method, in particular to a quantitative detection method for unusual genetic mutation. The quantitative detection method for unusual genetic mutation comprises the following steps: firstly, corresponding primer sequences are designed and prepared according to the unusual genetic mutation required for quantitative detection, wherein the 3' end of a primer is provided with a mutant site - special nucleotide; except for the final site of the nucleotide, all the other sequences can be synthesized by commercial means; and the final site of the nucleotide is modified nucleotide, so as to make the primer incapable of extending in the general PCR reaction; and the modified nucleotide is added to the tail of the primer; and secondly, in a reaction system which contains special DNA polymerase and pyrophosphate, the primer designed and prepared in the first step is adopted for amplifying the unusual genetic mutation for quantitative detection, and a real-time fluorescent PCR instrument is utilized for quantitative detection; and the quantitative detection information of the unusual genetic mutation can be acquired through analysis of an amplifying curve recorded by the real-time fluorescent PCR instrument.

Description

technical field [0001] The invention relates to a gene detection method, in particular to a quantitative detection method for rare gene mutations. Background technique [0002] Rare mutations refer to relatively rare mutant DNA sequences that exist in the background of a large number of wild-type DNA sequences, such as a small amount of tumor mutation gene DNA contained in the blood of cancer patients, a small amount of tumor mutation DNA remaining in the blood of cancer patients after treatment, pregnant women A small amount of fetal DNA contained in the blood, drug-resistant mutations of bacteria or viruses that appeared in the early stages, etc., all belong to the category of rare mutations, and rare mutations in the narrow sense generally refer to point mutations. The above-mentioned mutations are often associated with diseases, or are the direct cause of a disease, or are early signs or important biomarkers of a disease. Therefore, rare mutations are closely related to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68G01N21/64
Inventor李庆阁郭奇伟阮力胡思玉
OwnerXIAMEN UNIV