Construction method and use of Mycobacterium tuberculosis gene expression library

A Mycobacterium tuberculosis gene expression technology, applied in the field of bioengineering, can solve the problem of not reflecting the Mycobacterium tuberculosis antigen, and achieve high throughput, low operation cost and high coverage

Inactive Publication Date: 2009-07-22
HUAZHONG AGRI UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Its disadvantage is that it can only detect a small amount of antigens that can only exist in urine, and cannot reflect all the antigens secreted by Mycobacterium tuberculosis when it exists in the human body

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and use of Mycobacterium tuberculosis gene expression library
  • Construction method and use of Mycobacterium tuberculosis gene expression library
  • Construction method and use of Mycobacterium tuberculosis gene expression library

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Embodiment 1: PCR amplification of Mycobacterium tuberculosis gene

[0058] Using the total genome DNA of Mycobacterium tuberculosis H37Rv (accession number: NC000962) as a template, the genome coding gene of Mycobacterium tuberculosis was amplified with primers designed according to the nucleic acid sequence of Mycobacterium tuberculosis H37Rv genome provided by GenBank.

[0059] The primer design method of the coding gene of Mycobacterium tuberculosis: according to the restriction site inside the coding gene, select the restriction site combination that does not have inside the gene (EcoRI and XbaI, EcoRI and XhoI, NotI and XbaI, NotI and XhoI, BamHI and XhoI), take 20bp from the front and back of the coding gene to design primers, and adjust the GC content of the upstream and downstream primers to achieve consistency through the change of the terminal protection bases. The specific primers are as follows (taking 24 pairs of primers as an example):

[0060] R1325cf: A...

Embodiment 2

[0115] Embodiment 2: Transformation of expression vector pETEXba

[0116] (1) Eliminate the XbaI cleavage site on the commercially available pET28a (purchased from Novagen) vector by the method of end-filling modification (for specific methods, refer to the method of using T4DNA Polymerase of Takara Company), and obtain an intermediate vector named pET28a -△X;

[0117] (2) The intermediate vector pET28a-ΔX obtained in step (1) is digested with restriction endonucleases NdeI and XhoI;

[0118] (3) The cdc62 gene (Genebank ID: 1455035) of the extreme thermophilic archaea S. solfataricus was used as the first vector gene of the transformation vector. Amplified from the genome of the extreme thermophilic archaea S. solfataricus by PCR (forward primer 14bEcoR-f: GCGCGG CATATG A GAATTC ATGAGTGATATAATTGATGAG, reverse primer 14hEcoR-r: ATATGA CTCGAG TACTCCAGAGATCAGCAAACCT, the underline is the restriction site) obtained from the cdc62 gene fragment containing NdeI and XhoI rest...

Embodiment 3

[0125] Embodiment 3: Transformation of pGEX-4T-1 expression vector

[0126] (1) The mini-chromosome maintenance-like gene (mini-chromosome maintenance-likegene, MCM, Genebank ID: 1455038) of the extreme thermophilic archaea S. solfataricus was used as the original vector gene of the transformation vector. By PCR (forward primer Trgada-f: GAGC GAATTC GTTGGAAATTCCTAGTAAAC, reverse primer Adapter-r: GGATGG CTCGAG TCTAGACTAGACTTTTTGTAACAT, the underline is the restriction site) method to amplify the 2.0 kb MCM gene from the genome of the extreme thermophilic archaea S. solfataricus. Since there are two BamHI restriction endonuclease recognition sites inside the MCM, the fragment was fully digested with BamHI to form a fragment with a deletion of 844 bases. Subsequently, the fragment was treated by the end-filling modification method (for specific methods, refer to the T4DNA Polymerase usage method of Takara Company) to form a 1.2kb MCM mediator gene containing EcoRI and XhoI r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological engineering, in particular to a construction method and application of a mycobacterium tuberculosis gene expression library, and the invention is characterized in that two expression carriers pETEXba and pGEXMCM that are applicable to the construction of the mycobacterium tuberculosis gene expression library are prepared, all encoding genes of mycobacterium bacteria are obtained through PCR reaction and precisely cloned into the constructed expression carriers, and finally the mycobacterium tuberculosis gene expression library is obtained by transforming a colon bacillus expression strain BL21(DE3). The invention realizes preliminary application of the library and proves that the library can effectively filter new protection antigens. Nucleotide sequences of the constructed expression carriers pETEXba and pGEXMCM are described in SEQ ID NO.1 and SEQ ID NO.2. The method of the invention has low cost, high flux and high coverage rate, and can be used in the filtration of new protection antigens and medicine targets.

Description

technical field [0001] The invention belongs to the technical field of bioengineering. It specifically relates to a construction method and application of a Mycobacterium tuberculosis gene expression library. Background technique [0002] Robert Koch's first successful isolation of the bacterium Mycobacterium tuberculosis raised great hopes for defeating one of the world's major plagues. Yet 125 years later, Mycobacterium tuberculosis remains a widespread pathogen, infecting nearly one-third of humanity and killing about two million people each year (Raviglione M C. The TB epidemic from 1992 to 2002. Tuberculosis (Edinb), 2003, 83:4-14.). Mycobacterium tuberculosis has some difficult-to-treat features. It can adapt to a variety of adverse living conditions and can prevent the maturation of normal macrophages. M. tuberculosis is also capable of going dormant, allowing the infection to show no symptoms and remain dormant in the body for decades. When the host's immune sys...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/65C12N15/53C40B50/06C12R1/19C12R1/32
Inventor何正国李雨庆
OwnerHUAZHONG AGRI UNIV