Wheat response abiological stress resistance gene TaCEO and application thereof
A technology of abiotic stress and resistance gene, applied in wheat response to abiotic stress resistance gene TaCEO and its application field, can solve the problem that the role of TaCEO gene has not yet been reported, and achieve the effect of enhancing salt tolerance and drought resistance.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Embodiment 1, the cloning of TaCEO
[0027] 1.1 Wheat RNA extraction
[0028] (1) Put the tissue material treated with PEG osmotic stress into a liquid nitrogen precooled mortar, and fully grind it into powder in liquid nitrogen;
[0029] (2) After the liquid nitrogen evaporates to dryness, immediately transfer to a 2ml centrifuge tube, add about 1ml Trizol extract per 100mg of material, shake vigorously to fully lyse the sample, and place it at room temperature for 5 minutes;
[0030] (3) Centrifuge at 12,000 rpm for 15 minutes at 4°C;
[0031] (4) Carefully transfer the upper aqueous phase to a new 1.5ml centrifuge tube with a pipette, add 200μl chloroform (chloroform), shake vigorously for 15 seconds, and place at room temperature for 10 minutes;
[0032] Alcohol (1:1 volume), mix thoroughly, -20°C, precipitate for 30min or overnight;
[0033] (5) Centrifuge at 12,000 rpm for 15 minutes at 4°C;
[0034] (6) Carefully transfer the upper aqueous phase to a new 1.5m...
Embodiment 2
[0066] Embodiment 2, expression analysis of TaCEO
[0067] 2.1 Extraction of RNA under stress
[0068] The seeds of Shanrong No. 3 germinated normally, and when the Hoagland culture medium was cultured to a plant height of about 10cm (about 3 weeks), drought (18% PEG), salt stress (200mM NaCl), cold, ABA, H 2 o 2 and methyl viologen treatment. After treatment for different time, the seedling root and leaf RNA was extracted by Trizol method as above.
[0069] 2.2 Reverse transcription to obtain cDNA
[0070] cDNA was generated by reverse transcription and operated according to the instructions.
[0071] 2.3 PCR reaction and electrophoresis
[0072] (1) Using cDNA as a template, carry out PCR reaction. Primers are as follows:
[0073] 5' end primer: ATGGACTCGGAGCACTGGAT
[0074] 3' end primer: TCAGTCGTCTCCAAATAAAGTG
[0075] (2) PCR system:
[0076] wxya 2 O 12.6 μl
[0077] 10×Taq buffer(Mg2+free) 2μl
[0078] MgCl 2 (25mM) 1.2μl
[0079] Primer1 (5μM) 1μ1
[00...
Embodiment 3
[0089] Embodiment 3, the construction of plant expression vector (35S promoter)
[0090] The plant expression vector pBI121 is a binary vector containing 35S promoter and NPTII gene, and its multiple cloning site contains a recognition site for restriction endonuclease BamHI. Based on this, design primers containing BamHI recognition sequence upstream of the start codon and downstream of the stop codon of the target gene, and amplify the target gene with high-fidelity Taq enzyme. The system is the same as 1.4.
[0091] The fragments of the vector pBI121 and the amplified product of the target gene were respectively digested with the restriction endonuclease BamHI. The completely digested carrier was separated by electrophoresis on 0.8% agarose gel, recovered by gel, dephosphorylated by CIAP, and then ligated with the amplified fragment of the digested target gene.
[0092] enzyme digestion system
[0093] (1) Single digestion of plasmid BamHI
[0094] 10×Buffer 1μl
[0095...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
