Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Wheat response abiological stress resistance gene TaCEO and application thereof

A technology of abiotic stress and resistance gene, applied in wheat response to abiotic stress resistance gene TaCEO and its application field, can solve the problem that the role of TaCEO gene has not yet been reported, and achieve the effect of enhancing salt tolerance and drought resistance.

Inactive Publication Date: 2011-05-25
SHANDONG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But at present, the irrigated area of ​​this region is only about 20%, and the yield per unit area is only half of the national average. In typical semi-arid areas, such as the hilly and gully areas of the Loess Plateau, the irrigated area is less than 10%, and the yield per unit area is only three times the national average. one-third
In recent years, experiments have shown that the CEO protein in Arabidopsis can improve the antioxidant capacity of yeast, but there is no report on the role of TaCEO gene in the process of plant drought resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wheat response abiological stress resistance gene TaCEO and application thereof
  • Wheat response abiological stress resistance gene TaCEO and application thereof
  • Wheat response abiological stress resistance gene TaCEO and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1, the cloning of TaCEO

[0027] 1.1 Wheat RNA extraction

[0028] (1) Put the tissue material treated with PEG osmotic stress into a liquid nitrogen precooled mortar, and fully grind it into powder in liquid nitrogen;

[0029] (2) After the liquid nitrogen evaporates to dryness, immediately transfer to a 2ml centrifuge tube, add about 1ml Trizol extract per 100mg of material, shake vigorously to fully lyse the sample, and place it at room temperature for 5 minutes;

[0030] (3) Centrifuge at 12,000 rpm for 15 minutes at 4°C;

[0031] (4) Carefully transfer the upper aqueous phase to a new 1.5ml centrifuge tube with a pipette, add 200μl chloroform (chloroform), shake vigorously for 15 seconds, and place at room temperature for 10 minutes;

[0032] Alcohol (1:1 volume), mix thoroughly, -20°C, precipitate for 30min or overnight;

[0033] (5) Centrifuge at 12,000 rpm for 15 minutes at 4°C;

[0034] (6) Carefully transfer the upper aqueous phase to a new 1.5m...

Embodiment 2

[0066] Embodiment 2, expression analysis of TaCEO

[0067] 2.1 Extraction of RNA under stress

[0068] The seeds of Shanrong No. 3 germinated normally, and when the Hoagland culture medium was cultured to a plant height of about 10cm (about 3 weeks), drought (18% PEG), salt stress (200mM NaCl), cold, ABA, H 2 o 2 and methyl viologen treatment. After treatment for different time, the seedling root and leaf RNA was extracted by Trizol method as above.

[0069] 2.2 Reverse transcription to obtain cDNA

[0070] cDNA was generated by reverse transcription and operated according to the instructions.

[0071] 2.3 PCR reaction and electrophoresis

[0072] (1) Using cDNA as a template, carry out PCR reaction. Primers are as follows:

[0073] 5' end primer: ATGGACTCGGAGCACTGGAT

[0074] 3' end primer: TCAGTCGTCTCCAAATAAAGTG

[0075] (2) PCR system:

[0076] wxya 2 O 12.6 μl

[0077] 10×Taq buffer(Mg2+free) 2μl

[0078] MgCl 2 (25mM) 1.2μl

[0079] Primer1 (5μM) 1μ1

[00...

Embodiment 3

[0089] Embodiment 3, the construction of plant expression vector (35S promoter)

[0090] The plant expression vector pBI121 is a binary vector containing 35S promoter and NPTII gene, and its multiple cloning site contains a recognition site for restriction endonuclease BamHI. Based on this, design primers containing BamHI recognition sequence upstream of the start codon and downstream of the stop codon of the target gene, and amplify the target gene with high-fidelity Taq enzyme. The system is the same as 1.4.

[0091] The fragments of the vector pBI121 and the amplified product of the target gene were respectively digested with the restriction endonuclease BamHI. The completely digested carrier was separated by electrophoresis on 0.8% agarose gel, recovered by gel, dephosphorylated by CIAP, and then ligated with the amplified fragment of the digested target gene.

[0092] enzyme digestion system

[0093] (1) Single digestion of plasmid BamHI

[0094] 10×Buffer 1μl

[0095...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a response abiological stress (salt, drought, and the like) resistance gene TaCEO and a plant expression vector RhoBI121 / TaCEO with the gene TaCEO. The invention also discloses the gene TaCEO and the application of the plant expression vector with the gene TaCEO for cultivating abiological stress resistance (salt, drought, and the like). An experiment proves that the abiological stress resistance (salt, drought, and the like) ability for expressing transgenic plants is obviously increased.

Description

technical field [0001] The invention belongs to the technical field of biogenetic engineering, and in particular relates to a wheat response abiotic stress resistance gene TaCEO and its application. Background technique [0002] my country is a country with a relatively large area of ​​arid and semi-arid areas in the world. The dry land area accounts for 52.5% of the total land area of ​​the country. Among them, the typical area - the Loess Plateau soil erosion area, the cultivated land accounts for about 1 / 3 of the semi-arid area, and the sloping cultivated land accounts for 1 / 3 of the semi-arid area. to 75% of the arable land area, the average unit (667m 2 ) output is less than 150kg, and in many places it is still below 100kg. But at present, the irrigated area of ​​this region is only about 20%, and the yield per unit area is only half of the national average. In typical semi-arid areas, such as the hilly and gully areas of the Loess Plateau, the irrigated area is less t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82
Inventor 夏光敏刘栓桃王勐骋谢翔
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com