Preparation method of traceable enzyme calibration substance
A substance and matrix technology, applied in the field of preparation of traceable enzyme calibration substances, can solve problems such as product valuation contradictions, lack of traceability analysis, etc., and achieve good interchangeability and traceability, wide application, and reliable methods.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Publication Date
- 2009-09-16
- Estimated Expiration
- Not applicable · inactive patent
Smart Images
Figure 1 Figure 2 Figure 3
Abstract
Description
Technical field
[0001] The invention relates to a method for preparing a traceable enzyme calibration substance with good interchangeability for laboratory medicine, and belongs to the technical field of in vitro diagnostic reagents for medical tests. Background technique:
[0002] The measurement of enzyme activity is the most frequent measurement item in clinical testing, which is of great significance. However, due to the characteristics of the existing clinical testing system and enzyme reaction, there are many problems in actual work. Firstly, the determination of enzyme activity concentration is obtained by indirect calculation; secondly, there are many factors that affect the correct determination of enzyme concentration; in addition, due to the small sampling volume of test samples in clinical testing, multiple tests may be required for each sample; Timely reporting and other reasons have sacrificed method specificity and accuracy to a certain extent. As a result, there a...
Examples
Embodiment
[0020] Example: Take creatine kinase as an example
[0021] 1. Human-derived serum enzyme gene cloning and expression
[0022] 1. The specific construction process of creatine kinase gene expression vector pET21b-HMCK: using the full-length human creatine kinase cDNA (Genbank: NM-001824) as a template, design the creatine kinase upstream and downstream primers respectively,
[0023] The upstream primer is: GATTATTCATATGCCATTCGGTAACACC;
[0024] The downstream primer is: AAGGATCCTACTTCTGGGCGGG; after the target fragment is amplified with the corresponding primer, it is digested with NdeI and BamHI and then cloned into the pET21b plasmid to construct the expression vector pET21b-HMCK. It was identified by single restriction digestion and multiple double restriction digestion, and sequenced, which was consistent with the expected results.
[0025] 2. Optimal expression of protein: transfer the constructed expression vector to BL21 strain, culture in LB liquid medium containing ampici...