Preparation method of traceable enzyme calibration substance
A substance and matrix technology, applied in the field of preparation of traceable enzyme calibration substances, can solve problems such as product valuation contradictions, lack of traceability analysis, etc., and achieve good interchangeability and traceability, wide application, and reliable methods.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0020] Example: Take creatine kinase as an example
[0021] 1. Human-derived serum enzyme gene cloning and expression
[0022] 1. The specific construction process of creatine kinase gene expression vector pET21b-HMCK: using the full-length human creatine kinase cDNA (Genbank: NM-001824) as a template, design the creatine kinase upstream and downstream primers respectively,
[0023] The upstream primer is: GATTATTCATATGCCATTCGGTAACACC;
[0024] The downstream primer is: AAGGATCCTACTTCTGGGCGGG; after the target fragment is amplified with the corresponding primer, it is digested with NdeI and BamHI and then cloned into the pET21b plasmid to construct the expression vector pET21b-HMCK. It was identified by single restriction digestion and multiple double restriction digestion, and sequenced, which was consistent with the expected results.
[0025] 2. Optimal expression of protein: transfer the constructed expression vector to BL21 strain, culture in LB liquid medium containing ampici...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com