Bovine lactoferrin antibacterial peptide fusion protein, coding gene and application thereof

A fusion protein and fusion protein technology are applied to bovine lactoferrin antibacterial peptide fusion protein and its encoding gene and application fields, and can solve the problems of few lactoferrin antibacterial peptide genes, unable to achieve production and application, unsatisfactory expression and the like

Inactive Publication Date: 2010-01-20
CHINA AGRI UNIV
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there have been many studies on the genetic transformation of lactoferrin, but there are few studies on the transformation of the lactoferrin antimicrobial peptide gene. It is only found that the gene can be normally expressed in plants such as tobacco, corn, soybean, etc., and has an antibacterial effect, but the expression The quantity is not ideal and cannot meet the requirements of production and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bovine lactoferrin antibacterial peptide fusion protein, coding gene and application thereof
  • Bovine lactoferrin antibacterial peptide fusion protein, coding gene and application thereof
  • Bovine lactoferrin antibacterial peptide fusion protein, coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1, two copies of the lactoferrin antimicrobial peptide gene are connected in series

[0054] 1. PCR amplification of lactoferrin antimicrobial peptide gene

[0055] Two long single-stranded DNAs were synthesized by Shanghai Shenyou,

[0056] First chain:

[0057] 5'ACGGGAGCTCAGATCTTCAACAATGGAGTGGTTCAAGTGCCGCCGCTGGCAGTGGCGCATGAAGAAGCTGGGCGCCCCCA 3'

[0058] Second chain:

[0059] 5'AGCTGGTCACCTCTAGATCAGAAGGCGCGGCGCACGCAGGTGATGCTGGGGGCGCCCCAGCTTCTTCATGCGCCACTGCCA 3'

[0060] The two chains are annealed and filled to form a double-chain bovine lactoferrin antimicrobial peptide coding sequence.

[0061] The annealing and filling conditions are: 50uM 1ul of the first strand, 50uM 1ul of the second strand, 0.5ul of Taq DNA polymerase, 2μl of dNTP mixture, 5μl of 10×PCR buffer, MgCl 2 (25uM) 3ul, add water to a final volume of 50ul.

[0062] The above reactant was placed in a 94°C hot water bath, the temperature of the hot water was gradually lowered to 65°C, ...

Embodiment 2

[0077] Example 2, Preparation of the tandem fragment flfc of four lactoferrin antimicrobial peptide gene copies

[0078] 1. PCR amplification of tlfc

[0079] The pGEM-T Easy / tlfc plasmid was used as a template, tlfc1 was amplified with tlfc1SP and tlfc1ASP as a primer pair, and tlfc2 was amplified with tlfc2SP and tlfc2ASP as a primer pair.

[0080] The primer sequences are as follows:

[0081] tlfc1SP 5′ CGGGAGCTCAGATCTTCAACAATGGAGTGGTT 3′;

[0082] tlfc1ASP 5'TCACCTCTAGACCAGAAGGCGCGGCG 3';

[0083] tlfc2SP 5'AGTCTAGAATTGAAGGAAGGGAGTGGTTCAAGT 3';

[0084] tlfc2ASP 5'GGTGGTCACCAGATCAGAAGGCGC 3'.

[0085] The PCR amplification reaction system and reaction procedure were the same as in Example 1.

[0086] PCR products were subjected to agarose gel electrophoresis, such as Figure 4 As shown in a, the PCR products of tlfc1 and tlfc2 were recovered, and tlfc1 and tlfc2 were respectively cloned into the pGEM-T Easy vector to construct recombinant plasmids, which were named p...

Embodiment 3

[0090] Embodiment 3, the acquisition of pCAMBIA3301 / tlfc and pCAMBIA3301 / flfc tobacco

[0091] 1) Construction of plant expression vector pCAMBIA3301 / tlfc and pCAMBIA3301 / flfc

[0092] Digest pGEM-T Easy / tlfc and pGEM-T Easy / flfc plasmids and pCAMBIA3301 plasmids with Bgl II and BstE II respectively, and recover the required fragments, the sizes are 214bp, 415bp and 9.3Kb respectively, and the 214bp fragment of tlfc will be recovered and the 415bp fragment of flfc were respectively ligated with the recovered 9.3Kb fragment of pCAMBIA3301, and the T4 DNA ligase ligation reaction was performed for 4 hours (16°C water bath). Select positive clones, use lfc1SP and lfc2ASP, tlfc1SP and tlfc2ASP as primers for bacterial liquid PCR detection, select bacterial liquid PCR to identify the correct plasmid, and use multi-combination endonucleases for enzyme digestion identification. The results of PCR detection and enzyme digestion identification were as follows: Figure 5 as shown, F...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a bovine lactoferrin antibacterial peptide fusion protein, a coding gene and application thereof. The bovine lactoferrin antibacterial peptide fusion protein is a protein in a) or b) as follows: a) the protein formed by fusing two or more than two polypeptides shown at 4th to 28th position from an amino terminal in a sequence 2 in a sequence table; and b) the a)-derived protein which is obtained by substituting and / or deleting and / or adding one or more amino acid residues in an amino acid sequence of the protein limited by the a) and has antibacterial activity. The invention also discloses the coding gene of the bovine lactoferrin antibacterial peptide fusion protein. The bovine lactoferrin antibacterial peptide fusion protein and plants cultivated by the coding gene can be utilized as bioreactors to produce antimicrobial peptides.

Description

technical field [0001] The invention relates to a bovine lactoferrin antibacterial peptide fusion protein, its encoding gene and application. Background technique [0002] Lactoferrin (Lactoferrin LF), also known as lactoferrin, mainly refers to the globulin present in mammalian whey, which was first isolated from bovine milk by Sorensen M and Sorensen SPL (1938). At present, the primary structure of the polypeptide chain in lactoferrin has been clarified. Lactoferrin is composed of about 690 amino acids. Human lactoferrin has a molecular weight of 82.4KDa and 692 amino acid residues; bovine lactoferrin has a molecular weight of 83.1KDa. , consisting of 689 amino acids. Their structures are similar. The corresponding antimicrobial peptide (Lfcin) can be obtained by hydrolyzing human, bovine and porcine LF with pepsin in vitro. Lfcin has a ring formed by disulfide bonds, which consists of 18 amino acids. Human Lfcin consists of LF residues 20 to 37 and bovine Lfcin consis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/11C12N15/82C12N5/10C12N1/15C12N1/19C12N1/21A01H1/00C07K14/47
Inventor王建华王国英王春英
OwnerCHINA AGRI UNIV