Pichia pastoris engineered strain constructing method and dextranase preparing process
The technology of dextranase and Pichia pastoris is applied in the fields of genetic engineering and protein secretion and expression, and can solve the problems that dextranase cannot be well adapted to the temperature and pH of the sugar-making process, there is no dextranase, and the preparation cost is high, and the invention can achieve The effect of fast growth, efficient secretion and expression, and cost reduction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0031] A method for constructing a Pichia pastoris genetically engineered strain with high production of dextranase, comprising the steps of:
[0032] (1) Design oligonucleotide primers Primer1: GCGCGAATTCATGACATTAATCT and Primer2: ATCGCGGCCGCGTTTATGGACCATTG, respectively introduce restriction endonucleases EcoRI and NotI into the primers, and use the oleaginous yeast 1390 genomic DNA as a template to clone the dextranase gene;
[0033] (2) Using the secretory expression vector pPIC9K, insert the double-digested dextranase gene into the multiple cloning site (EcoRI and NotI) of pPIC9K, and construct an integrated secretory gene through molecular biology techniques such as ligation, transformation, and enzyme digestion. type expression vector pPIC9K-139;
[0034] (3) Linearize the recombinant expression vector pPIC9K-139 with restriction endonuclease Bgl II, transform Pichia pastoris GS115 by electroporation, use α-factor to realize the secreted expression of dextranase, and sc...
Embodiment 2
[0036] A kind of technique (shaking flask fermentation culture) of preparing dextranase, its step is as follows:
[0037] (1) Medium formula: the basal medium is composed of 10×Basal salt+250×PTM1+5% (w / v) glucose+0.02% glycerol;
[0038] (2) Inoculation: the Pichia pastoris engineering strain GS115-139 of embodiment 1 is planted on the above-mentioned culture medium, and the culture conditions are: temperature is 28~30°C, pH5.0~5.6, rotating speed 250r / min;
[0039] (3) Induction of dextranase production: After 24 hours of inoculation and culture, methanol was added as an inducer, and the concentration of methanol was in the range of 0-1%. After culturing for 96 hours, the enzyme activity of dextranase in the culture medium was determined to be 26U.
[0040] (4) Separation and purification of dextranase: adopt centrifugation and filtration to separate cells, then select an appropriate ultrafiltration membrane to cut off, concentrate the fermentation broth, carry out low-temp...
Embodiment 3
[0042] A kind of technique (shaking flask fermentation culture) of preparing dextranase, its step is as follows:
[0043] (1) Medium formula: the basal medium is composed of 10×Basal salt+250×PTM1+5% (w / v) glucose+0.02% foam enemy;
[0044](2) Inoculation: the Pichia pastoris engineering strain GS115-139 of embodiment 1 is planted on the above-mentioned medium for cultivation, and the cultivation conditions are: temperature is 30~33°C, pH5.0~5.5, rotating speed 200r / min;
[0045] (3) Induction of dextranase production: After 48 hours of inoculation and culture, methanol was added as an inducer, and the concentration of methanol was in the range of 0-1%. After culturing for 96 hours, the enzyme activity of dextranase in the culture medium was determined to be 30U.
[0046] (4) Separation and purification of dextranase: adopt centrifugation and filtration to separate cells, then select an appropriate ultrafiltration membrane to cut off, concentrate the fermentation broth, carry...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap