Pichia pastoris engineered strain constructing method and dextranase preparing process

The technology of dextranase and Pichia pastoris is applied in the fields of genetic engineering and protein secretion and expression, and can solve the problems that dextranase cannot be well adapted to the temperature and pH of the sugar-making process, there is no dextranase, and the preparation cost is high, and the invention can achieve The effect of fast growth, efficient secretion and expression, and cost reduction

Inactive Publication Date: 2010-02-03
GUANGZHOU SUGARCANE IND RES INST
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, dextranase is mainly obtained from bacterial strains such as Penicillium lilacinum and Chaetomium sp., and there are also reports on the construction of engineering bacteria using the genes from the above sources, but the prepared dextranase is not very good. adapt to the temperature and pH in the sugar making process, and the preparation cost is high, so there are no reports of dextranase widely used in the sugar making industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] A method for constructing a Pichia pastoris genetically engineered strain with high production of dextranase, comprising the steps of:

[0032] (1) Design oligonucleotide primers Primer1: GCGCGAATTCATGACATTAATCT and Primer2: ATCGCGGCCGCGTTTATGGACCATTG, respectively introduce restriction endonucleases EcoRI and NotI into the primers, and use the oleaginous yeast 1390 genomic DNA as a template to clone the dextranase gene;

[0033] (2) Using the secretory expression vector pPIC9K, insert the double-digested dextranase gene into the multiple cloning site (EcoRI and NotI) of pPIC9K, and construct an integrated secretory gene through molecular biology techniques such as ligation, transformation, and enzyme digestion. type expression vector pPIC9K-139;

[0034] (3) Linearize the recombinant expression vector pPIC9K-139 with restriction endonuclease Bgl II, transform Pichia pastoris GS115 by electroporation, use α-factor to realize the secreted expression of dextranase, and sc...

Embodiment 2

[0036] A kind of technique (shaking flask fermentation culture) of preparing dextranase, its step is as follows:

[0037] (1) Medium formula: the basal medium is composed of 10×Basal salt+250×PTM1+5% (w / v) glucose+0.02% glycerol;

[0038] (2) Inoculation: the Pichia pastoris engineering strain GS115-139 of embodiment 1 is planted on the above-mentioned culture medium, and the culture conditions are: temperature is 28~30°C, pH5.0~5.6, rotating speed 250r / min;

[0039] (3) Induction of dextranase production: After 24 hours of inoculation and culture, methanol was added as an inducer, and the concentration of methanol was in the range of 0-1%. After culturing for 96 hours, the enzyme activity of dextranase in the culture medium was determined to be 26U.

[0040] (4) Separation and purification of dextranase: adopt centrifugation and filtration to separate cells, then select an appropriate ultrafiltration membrane to cut off, concentrate the fermentation broth, carry out low-temp...

Embodiment 3

[0042] A kind of technique (shaking flask fermentation culture) of preparing dextranase, its step is as follows:

[0043] (1) Medium formula: the basal medium is composed of 10×Basal salt+250×PTM1+5% (w / v) glucose+0.02% foam enemy;

[0044](2) Inoculation: the Pichia pastoris engineering strain GS115-139 of embodiment 1 is planted on the above-mentioned medium for cultivation, and the cultivation conditions are: temperature is 30~33°C, pH5.0~5.5, rotating speed 200r / min;

[0045] (3) Induction of dextranase production: After 48 hours of inoculation and culture, methanol was added as an inducer, and the concentration of methanol was in the range of 0-1%. After culturing for 96 hours, the enzyme activity of dextranase in the culture medium was determined to be 30U.

[0046] (4) Separation and purification of dextranase: adopt centrifugation and filtration to separate cells, then select an appropriate ultrafiltration membrane to cut off, concentrate the fermentation broth, carry...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of genetic engineering and the field of protein secretion expression and provides a method for constructing a pichia pastoris engineered strain used for preparing dextranase. The method comprises the following steps: (1) designing an oligonucleotides primer and taking lipomyces 1390 genome DNA as a template; cloning to obtain dextranase genes; (2) utilizing a secretion expression carrier pPIC9K to insert the dextranase genes into multi-cloning sites (EcoRI and NotI) of the pPIC9K so as to construct an integral secretion-type expression carrier pPIC9K-139; and(3) linearizing the reconstructed expression carrier pPIC9K-139 so as to realize the high-efficiency secretion expression of the dextranase, and obtaining the reconstructed pichia pastoris engineeredstrain GS115-139 by means of selection. The method successfully realizing the effective expression of the dextranase genes in pichia pastoris, constructs the engineered strain which can efficiently secrete and express the dextranase, and realizes the expansion of a fermentation process of the dextranase.

Description

technical field [0001] The invention relates to the field of genetic engineering and protein secretion and expression, in particular to the construction of Pichia pastoris engineering strains that secrete and express dextranase, and the preparation process of dextranase. Background technique [0002] In the sugar industry, due to the impact of sugarcane varieties, weather, soil and sugar factory production environment, the materials contain different amounts of dextran, resulting in a direct sugar loss of about 1.0%; the existence of dextran makes the production The difficulties in the sugar process increase, mainly reflected in the existence of false optical rotation, increased viscosity of sugar solution, difficulty in filtration, abnormal crystallization, increased energy consumption, and reduced quality, etc. The sugar loss caused by this is 3-5 times the direct sugar loss. times, that is, the loss of sugar due to dextran in the traditional sugar making process is about ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/81C12N9/46C12R1/84
Inventor梁达奉曾练强郭亭卢英华蚁细苗李雨虹陈龙军张远平黄玉南钟映萍敬科举
OwnerGUANGZHOU SUGARCANE IND RES INST