Nucleic acid chip for obtaining bind profile of single strand nucleic acid and unknown biomolecule, manufacturing method thereof and analysis method of unknown biomolecule using nucleic acid chip
A single-stranded nucleic acid, biomolecule technology, applied in biochemical equipment and methods, microbial determination/inspection, biological testing, etc., can solve problems such as protein chip limitations, expensive, expensive devices and reagents, and achieve low-cost effects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0067] Embodiment 1 is bound to the preparation of the single-stranded nucleic acid of human serum albumin
[0068] Such as figure 1 As shown, using DNA oligonucleotides of single-stranded nucleic acid having the following optional base sequence, after preparing double-stranded DNA by PCR (polymerase chain reaction), RNA library of single-stranded nucleic acid was produced by in vitro transcription (optional single-stranded nucleic acid).
[0069] 5′- GGGAGAGCGGAAGCGTGCTGGGCC N 40
[0070] CATAACCCAGAGGTCGATGGATCCCCCC -3' (the underlined base arrangement here is the constant region (invariable regions), N 40 means that the four bases A, G, T, and C exist at the same concentration at each position. )
[0071] The FW primer used for PCR as shown in SEQ ID NO.1 can carry out base pairing with the base 5' end of the underlined part of the above base arrangement, and includes the promoter base sequence of the RNA polymerase of bacteriophage T7 . The RE primer of SEQ ID ...
Embodiment 2
[0081] The preparation of embodiment 2 nucleic acid chips
[0082] Chemically synthesized (Bioneer Corporation, Korea) single-stranded nucleic acid (oligonucleotide) having a base sequence complementary to the base sequence of more than 3,000 biomolecule-binding single-stranded RNAs determined in Example 1, as an immobilized Capture of single-stranded nucleic acids on a glass substrate.
[0083] The captured single-stranded nucleic acids are sequentially immobilized on a GAPS (gamma aminopropyl silane) substrate (such as an UltraGAPS™ coated substrate (Corning Company)) to prepare a nucleic acid chip.
[0084] A microarray system (Microarrayer system, GenPak, Inc.) using a pin method was used to fabricate the nucleic acid chip, and the spot spacing was set to 370 μm center-to-center. Each captured single-stranded nucleic acid is dissolved in a standard solution and the concentration is adjusted. At this time, the humidity in the array was maintained at 70%, and spotting was ...
Embodiment 3
[0085] Embodiment 3 Preparation of human serum (biomolecule)-target single-stranded nucleic acid complex and target single-stranded nucleic acid
[0086] The plasmids prepared in Example 1 for carrying the single-stranded nucleic acid that binds to the biomolecule used to prepare the nucleic acid chip were mixed in equal amounts to prepare transcripts for preparing the single-stranded nucleic acid pool that binds to the unknown biomolecule plasmid pool. A pool of single-stranded nucleic acids bound to human serum albumin was prepared from the plasmid pool using chemically synthesized PCR primers followed by in vitro transcription.
[0087] In the prepared plasmid pool, 1pg plasmid was used as transcript, and passed standard PCR in PCR buffer solution containing 100pM 5′-primer, 100pM 3′-primer, dNTP mixture (5mM dATP, 5mM dCTP, 5mM dGTP, 5mM dTTP) Methods Repeat 30 cycles at 94°C for 30 seconds, 52°C for 30 seconds, and 72°C for 20 seconds to synthesize double-stranded nuclei...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap