Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleic acid chip for obtaining bind profile of single strand nucleic acid and unknown biomolecule, manufacturing method thereof and analysis method of unknown biomolecule using nucleic acid chip

A single-stranded nucleic acid, biomolecule technology, applied in biochemical equipment and methods, microbial determination/inspection, biological testing, etc., can solve problems such as protein chip limitations, expensive, expensive devices and reagents, and achieve low-cost effects.

Inactive Publication Date: 2010-03-03
GENOPROT
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods suffer from the following disadvantages: need to use expensive devices and reagents; require complicated procedures; and can only be applied to antibody molecules
[0017] As described above, the development of using protein chips and aptamers to reveal the quantitative state of biomolecules in biological samples has the disadvantages of using expensive devices and reagents, and requiring complicated operations
In particular, the developed protein chips or aptamer chips are also limited by the proteins from which antibodies or aptamers are made

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid chip for obtaining bind profile of single strand nucleic acid and unknown biomolecule, manufacturing method thereof and analysis method of unknown biomolecule using nucleic acid chip
  • Nucleic acid chip for obtaining bind profile of single strand nucleic acid and unknown biomolecule, manufacturing method thereof and analysis method of unknown biomolecule using nucleic acid chip
  • Nucleic acid chip for obtaining bind profile of single strand nucleic acid and unknown biomolecule, manufacturing method thereof and analysis method of unknown biomolecule using nucleic acid chip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Embodiment 1 is bound to the preparation of the single-stranded nucleic acid of human serum albumin

[0068] Such as figure 1 As shown, using DNA oligonucleotides of single-stranded nucleic acid having the following optional base sequence, after preparing double-stranded DNA by PCR (polymerase chain reaction), RNA library of single-stranded nucleic acid was produced by in vitro transcription (optional single-stranded nucleic acid).

[0069] 5′- GGGAGAGCGGAAGCGTGCTGGGCC N 40

[0070] CATAACCCAGAGGTCGATGGATCCCCCC -3' (the underlined base arrangement here is the constant region (invariable regions), N 40 means that the four bases A, G, T, and C exist at the same concentration at each position. )

[0071] The FW primer used for PCR as shown in SEQ ID NO.1 can carry out base pairing with the base 5' end of the underlined part of the above base arrangement, and includes the promoter base sequence of the RNA polymerase of bacteriophage T7 . The RE primer of SEQ ID ...

Embodiment 2

[0081] The preparation of embodiment 2 nucleic acid chips

[0082] Chemically synthesized (Bioneer Corporation, Korea) single-stranded nucleic acid (oligonucleotide) having a base sequence complementary to the base sequence of more than 3,000 biomolecule-binding single-stranded RNAs determined in Example 1, as an immobilized Capture of single-stranded nucleic acids on a glass substrate.

[0083] The captured single-stranded nucleic acids are sequentially immobilized on a GAPS (gamma aminopropyl silane) substrate (such as an UltraGAPS™ coated substrate (Corning Company)) to prepare a nucleic acid chip.

[0084] A microarray system (Microarrayer system, GenPak, Inc.) using a pin method was used to fabricate the nucleic acid chip, and the spot spacing was set to 370 μm center-to-center. Each captured single-stranded nucleic acid is dissolved in a standard solution and the concentration is adjusted. At this time, the humidity in the array was maintained at 70%, and spotting was ...

Embodiment 3

[0085] Embodiment 3 Preparation of human serum (biomolecule)-target single-stranded nucleic acid complex and target single-stranded nucleic acid

[0086] The plasmids prepared in Example 1 for carrying the single-stranded nucleic acid that binds to the biomolecule used to prepare the nucleic acid chip were mixed in equal amounts to prepare transcripts for preparing the single-stranded nucleic acid pool that binds to the unknown biomolecule plasmid pool. A pool of single-stranded nucleic acids bound to human serum albumin was prepared from the plasmid pool using chemically synthesized PCR primers followed by in vitro transcription.

[0087] In the prepared plasmid pool, 1pg plasmid was used as transcript, and passed standard PCR in PCR buffer solution containing 100pM 5′-primer, 100pM 3′-primer, dNTP mixture (5mM dATP, 5mM dCTP, 5mM dGTP, 5mM dTTP) Methods Repeat 30 cycles at 94°C for 30 seconds, 52°C for 30 seconds, and 72°C for 20 seconds to synthesize double-stranded nuclei...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Disclosed are a nucleic acid chip for obtaining binding profiles between unknown biomolecules and single-stranded nucleic acids, a method for manufacturing the chip, and a method for analyzing the unknown biomolecules using the chip. The nucleic acid chip is used to analyze biological significance of the unknown biomolecule in the biospecimen. The nucleic acid chip can be manufactured by reactinga biospecimen containing an unknown biomolecule with random single-stranded nucleic acids having random base sequences to determine biomolecule-binding single stranded nucleic acids capable of bindingthe unknown biomolecule; and synthesizing capture single stranded nucleic acids composed of the determined biomolecule-binding single stranded nucleic acids and / or single stranded nucleic acids having base sequences complementary to those of said determined biomolecule-binding single stranded nucleic acids and affixing the capture single stranded nucleic acids on a substrate.

Description

technical field [0001] The invention relates to a nucleic acid chip for obtaining the combination spectrum of unknown biomolecules and single-stranded nucleic acid, a preparation method thereof, and a method for analyzing unknown biomolecules using the nucleic acid chip. Background technique [0002] Techniques for obtaining maps of unknown biomolecules (proteins and carbohydrates) have evolved with the development of physics, biochemistry and bioinformatics. However, the existing methods and devices have many problems in their use and maintenance costs, simplicity, accuracy, sensitivity, detection time, and process automation. Therefore, there is a high demand for effective new methods and devices. [0003] The method used to generate comprehensive information on the quantitative state of unknown biomolecules in biological samples (ie, the profile of unknown biomolecules) is not the ultimate goal, but a means to achieve the goal, but because it can be used for microorganism...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68G01N33/48
CPCC12Q1/6834C12Q1/6837
Inventor 金圣千
Owner GENOPROT