Supercharge Your Innovation With Domain-Expert AI Agents!

Recombination outer membrane protein, coding gene and expression vector of porcine actinobacillus pleuropneumoniae (APP) and preparation method thereof

A technology of porcine pleuropneumonia and outer membrane protein, applied in botany equipment and methods, microorganism-based methods, biochemical equipment and methods, etc., can solve the problem of lack of protein and achieve good antigenicity and high yield of expressed products Effect

Inactive Publication Date: 2010-04-07
TIANJIN AGRICULTURE COLLEGE
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no commercial product of this protein in China

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombination outer membrane protein, coding gene and expression vector of porcine actinobacillus pleuropneumoniae (APP) and preparation method thereof
  • Recombination outer membrane protein, coding gene and expression vector of porcine actinobacillus pleuropneumoniae (APP) and preparation method thereof
  • Recombination outer membrane protein, coding gene and expression vector of porcine actinobacillus pleuropneumoniae (APP) and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1, Preparation of APP OMP1

[0033] 1 main material

[0034] 1.1 The strain APP serotype 1 was provided by Professor Donahule, the number is ATCC33415 (CCM5586)

[0035] 1.2 Plasmid and Competence

[0036] The prokaryotic expression vector pET15b was preserved by the Laboratory of Preventive Veterinary Medicine, Department of Animal Science, Tianjin Agricultural College.

[0037] Competent DH5a and BL21(DE3) were purchased from Proboxin.

[0038] 2. Method

[0039] The methods in the following examples are conventional methods unless otherwise specified.

[0040] The percentages in the following examples are all mass percentages unless otherwise specified. 2.1 PCR method is used to amplify porcine pleuropneumonia OMP1 gene SEQ NO.1 from nucleotide 70 to 1395 at the 5' end, wherein the upstream primer is 5'TTA CTCGAG GGACGGTTCGCTTGAACAAG 3' contains Xho I restriction site primer, P2 (5'-CCC GGATCC CTATTCTTCTATATTTACCCGCC-3') is the 3' primer, BamHI restr...

Embodiment 2

[0060] 1. Main material

[0061] Primary antibody: porcine anti-APP polyclonal antibody, prepared by the Laboratory of Preventive Veterinary Medicine, Department of Animal Science, Tianjin Agricultural College.

[0062] Secondary antibody: HRP-labeled goat anti-pig IgG, purchased from Simege

[0063] 2. Method

[0064] The APP recombinant OMP1 obtained in Example 1 was subjected to 10% SDS-PAGE, and the protein on the gel was transferred to a nitrocellulose membrane at 230mA. After the membrane was rinsed with PBST, it was blocked overnight with 3% BSA, and the primary antibody (1:100 dilution ) to react for 2 hours, after fully rinsing with PBST, react with the secondary antibody (1:4000 dilution) for 2 hours, after fully rinsing with PBST, develop color, the results are shown in figure 2 , indicating that the expressed recombinant OMP1 has good antigenicity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombination outer membrane protein, a coding gene and an expression vector of porcine actinobacillus pleuropneumoniae (APP) and a preparation method thereof. The porcine actinobacillus pleuropneumoniae (APP) comprises recombination outer membrane protein (a) or (b), wherein (a) is a protein with amino acid sequence shown as SEQ NO.2, and (b) is a protein with immunological competence, which is derived from (a) and is obtained by replacing, deleting or adding one or a plurality of amino acids in the amino acid sequence of (a). The coding gene of the porcine actinobacillus pleuropneumoniae (APP) is one of the nucleotide sequences: (1) a DNA sequence shown as SEQ NO.1; and (2) a DNA sequence which has more than 90% of homology with the DNA sequence defined by SEQ NO.1 and codes proteins with the same function. By utilizing the gene provided by the invention, high expression product yield can be obtained, 13mg of recombination protein can be obtained in every 100mlLB culture medium, and the recombination protein has better antigenicity.

Description

technical field [0001] The invention relates to Actinobacillus pleuropneumoniae, in particular to a recombinant outer membrane protein, coding gene, expression vector and preparation method of Actinobacillus pleuropneumoniae. Background technique [0002] Porcine contagious pleuropneumoniae (PCP) is caused by Actinobacillus pleuropneumoniae (APP), which is a contagious disease with pulmonary hemorrhage, necrosis and fibrinous exudation as the main lesions. PCP is widely prevalent all over the world, often causing huge economic losses, and is internationally recognized as one of the five major diseases that endanger the modern pig industry. Paffison in the UK first reported the disease in 1957. Maffhews and Paffison isolated the bacterium from pigs in Argentina in 1961. It has been widely prevalent in the world by the 1980s, and it is increasing year by year. In recent years, it has been internationally recognized as one of the important infectious diseases that endanger the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/195C12N15/31C12N15/63C12N15/70C12P21/02C12R1/01C12R1/19
Inventor 杨建德刘燕霏徐军李本强马吉飞杨升杨百亮张安国
Owner TIANJIN AGRICULTURE COLLEGE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More