Recombination outer membrane protein, coding gene and expression vector of porcine actinobacillus pleuropneumoniae (APP) and preparation method thereof
A technology of porcine pleuropneumonia and outer membrane protein, applied in botany equipment and methods, microorganism-based methods, biochemical equipment and methods, etc., can solve the problem of lack of protein and achieve good antigenicity and high yield of expressed products Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1, Preparation of APP OMP1
[0033] 1 main material
[0034] 1.1 The strain APP serotype 1 was provided by Professor Donahule, the number is ATCC33415 (CCM5586)
[0035] 1.2 Plasmid and Competence
[0036] The prokaryotic expression vector pET15b was preserved by the Laboratory of Preventive Veterinary Medicine, Department of Animal Science, Tianjin Agricultural College.
[0037] Competent DH5a and BL21(DE3) were purchased from Proboxin.
[0038] 2. Method
[0039] The methods in the following examples are conventional methods unless otherwise specified.
[0040] The percentages in the following examples are all mass percentages unless otherwise specified. 2.1 PCR method is used to amplify porcine pleuropneumonia OMP1 gene SEQ NO.1 from nucleotide 70 to 1395 at the 5' end, wherein the upstream primer is 5'TTA CTCGAG GGACGGTTCGCTTGAACAAG 3' contains Xho I restriction site primer, P2 (5'-CCC GGATCC CTATTCTTCTATATTTACCCGCC-3') is the 3' primer, BamHI restr...
Embodiment 2
[0060] 1. Main material
[0061] Primary antibody: porcine anti-APP polyclonal antibody, prepared by the Laboratory of Preventive Veterinary Medicine, Department of Animal Science, Tianjin Agricultural College.
[0062] Secondary antibody: HRP-labeled goat anti-pig IgG, purchased from Simege
[0063] 2. Method
[0064] The APP recombinant OMP1 obtained in Example 1 was subjected to 10% SDS-PAGE, and the protein on the gel was transferred to a nitrocellulose membrane at 230mA. After the membrane was rinsed with PBST, it was blocked overnight with 3% BSA, and the primary antibody (1:100 dilution ) to react for 2 hours, after fully rinsing with PBST, react with the secondary antibody (1:4000 dilution) for 2 hours, after fully rinsing with PBST, develop color, the results are shown in figure 2 , indicating that the expressed recombinant OMP1 has good antigenicity.
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap