Foreign gene-carrying recombinant virus vector efficiently produced in packaging cell and construction method and application thereof

A technology of recombinant viral vectors and foreign genes, applied in the field of recombinant viral vectors, can solve the problems of inability to obtain virus titers, reducing the production efficiency of recombinant viruses, and the lack of time to assemble virus particles.

Active Publication Date: 2010-07-28
HEPATOBILIARY SURGERY HOSPITAL SECOND MILITARY MEDICAL UNIV
View PDF3 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, on the one hand, the overexpressed exogenous genes have certain toxicity to the cells, especially the suicide genes, apoptosis genes, cell cycle-related genes, etc., which lead to the premature death of the virus packaging cells and shorten the function of each functional gene of the recombinant virus in the packaging cells. On the other hand, a large amount of transcription

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Foreign gene-carrying recombinant virus vector efficiently produced in packaging cell and construction method and application thereof
  • Foreign gene-carrying recombinant virus vector efficiently produced in packaging cell and construction method and application thereof
  • Foreign gene-carrying recombinant virus vector efficiently produced in packaging cell and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0042] 1. Example 1: Construction of a recombinant adenovirus vector carrying the Rituxan gene and efficiently produced in 293 cells

[0043] 1. Construction of a replication-defective adenovirus vector carrying the Rituxan gene

[0044] The pDC315 vector was purchased from Microbix Biosystem Inc. (Toronto) in Canada. It contains a sequence fragment from 1417 to 2344 bp in the E1 region of the left arm of adenovirus type 5, and an inverted terminal repeat (ITR), which can be identical to the backbone plasmid containing the right arm of adenovirus. Source recombination to obtain replication-defective adenovirus. The pDC315 vector was modified by enzyme digestion, replaced the mCMV promoter, connected the EF1α (eukaryotic translation elongation factor 1 alpha) promoter and intron, a new multiple cloning site, retained the original SV40 PolyA signal sequence, and named the vector as pDC338 . The light chain and heavy chain gene sequences of Rituxan gene were amplified by polyme...

Example Embodiment

[0131] 2. Example 2: Construction of a recombinant lentivirus that carries the human P53 gene and can be efficiently produced in 293FT cells

[0132] 1. Construction of expression plasmid for lentiviral packaging containing human P53 gene

[0133] The pKCDNA-CMV--EF1α-GFP plasmid was purchased from Kangcheng Biotechnology Co., Ltd. It contains the expression cassette of the GFP gene under the control of the EF1α promoter, and the foreign gene can be expressed under the control of the CMV promoter. Human total RNA was extracted, single-stranded cDNA was synthesized by reverse transcriptase, and the open reading frame of human P53 gene was amplified from the single-stranded cDNA library by polymerase chain reaction (PCR) technology. It was named pKCDNA-P53.

[0134] Primer 5: CCG TCTAGA ACCATGGAGGAGCCGCAGTCAGA (SEQ ID NO: 7)

[0135] Primer 6: TGC GAATTC TCAGTCTGAGTCAGGCCC (SEQ ID NO: 8)

[0136] Primer 5 and primer 6 were amplified to obtain a 1197 bp coding region seque...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a foreign gene-carrying recombinant virus vector efficiently produced in a packaging cell and a construction method and application thereof. The foreign gene-carrying recombinant virus vector is characterized in that at least one target point nucleotide sequence of the following micro RNA is inserted into the 3' non-translational zone of a foreign gene connected with a virus in an operable way; and the micro RNA expresses at a high level in a virus packaging cell, and does not express or expresses at a low level in a target cell. Therefore, the invention realizes the selective inhibition of the expression of the foreign gene in the virus packaging cell, avoids the negative effect of the foreign gene on the virus packaging and production, and improves the production efficiency and titer of the virus. Simultaneously, the invention can not lower the expression level of the foreign gene in the target cell, and can not affect the therapeutic effect or the research onthe function of the foreign gene.

Description

Field of Invention [0001] The present invention generally relates to recombinant viral vectors. More specifically, the present invention relates to a type of recombinant viral vector carrying foreign genes efficiently produced in packaging cells, its construction method and its use. Background technique [0002] The virus has a high infection rate on specific cells, and can efficiently transduce foreign genes into cells and express them for a long time. It is often used as a tool for gene transfer to mediate the overexpression of foreign genes in target cells. gain-of-function approach to study gene function. On the other hand, viruses are also the most commonly used vectors for gene therapy. As of September 2008, 1,472 gene therapy programs have been used in clinical trials in the world, of which 1,006 clinical trials have used different types of viruses as vectors, accounting for 10% of the total. 68.3% (see database http: / / www.wiley.co.uk / genmed / clinical / ). [0003] Th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/86C12R1/93
Inventor 钱其军金华君李琳芳吕赛群吴孟超
Owner HEPATOBILIARY SURGERY HOSPITAL SECOND MILITARY MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap