Oligonucleotide mediated colibacillary gene knock-out or point mutation method

An oligonucleotide and Escherichia coli technology, applied in the field of genetic engineering, can solve the problems of increasing time and difficulty, affecting other gene expression, interfering with the overall structure of the genome, etc., to avoid polarity effects, high recombination efficiency, and easy operation line effect

Inactive Publication Date: 2010-08-25
NANJING NORMAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The existence of redundant sequences may interfere with the overall structure of the genome and affect the expression of other genes, such as polarity effects (and the expression of downstream genes in the same transcription direction are affected), which also brings difficulties to subsequent genetic modification
[0007] In order to achieve genetic modification of E. coli without any redundant bases, Yu et al. first cut the homologous fragment used for genetic modification, resistance gene, I-SceI enzyme and I-SceI enzyme that is not contained in the E. coli genome The site sequence is introduced into the E. coli genome, and the I-SceI enzyme induced by inactivated chlortetracycline catalyzes the homologous recombination of the homologous fragments on both sides of the I-SceI restriction site to include the resistance gene (Yu, B.J., et al., Rapid and efficient construction of markerless deletions in the Escherichia coli genome. Nucleic Acids Res, 2008.36 (14): e84.) The advantage of this method is to realize the removal of redundant sequences and large fragment gene knockout, the disadvantage is that it still needs to construct 400-500bp homologous fragments for gene modification by PCR, restriction enzyme digestion, ligase-mediated DNA fragment connection and other steps, which increases the time and difficulty

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oligonucleotide mediated colibacillary gene knock-out or point mutation method
  • Oligonucleotide mediated colibacillary gene knock-out or point mutation method
  • Oligonucleotide mediated colibacillary gene knock-out or point mutation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Embodiment 1. Construction of plasmid pSNR containing sacB-neo gene cassette

[0060] 1. Preparation and DNA transformation of Escherichia coli MG1655, DH10B and Escherichia coli BW25141 electroporation competent cells

[0061] Inoculate a freshly streaked single colony from the plate into 2ml LB liquid medium and shake overnight at 37°C, then transfer to 50ml LB at 1 / 50 volume, and shake until the cell OD 600 About 0.6. Pour the bacterial solution into a pre-cooled centrifuge tube, place in an ice bath for 10 minutes, centrifuge at 5000 rpm for 5 minutes at 4°C, and discard the supernatant. Wash the pellet twice with 10% glycerol, and finally suspend in 200 μl of 10% glycerol, and distribute in 50 μl per tube.

[0062] To prepare Escherichia coli competent cells containing the plasmid, corresponding antibiotics were added to the LB liquid medium during the culture of the strain.

[0063] Add the DNA to 50 μl of ice-thawed electroporation-competent cells, and mix well ...

Embodiment 2

[0080] Example 2. LacZ gene knockout

[0081] 1. Amplification of the sacB-neo gene cassette with homology arms

[0082] Design primer ZDE1: 5′- TGGCCGTCGTTTTACAACGTCG TGACTGGGAAAAC CCTGGCGTTACCCAA ATCCTTTTATGATTTTCTATC-3' (SEQ ID NO.3), the first 50 bases of the primer are the homology arm of the 23-72 position of the open reading frame of the LacZ gene (underlined), and the latter base is the front part of the sacB gene on the pSNR plasmid ;ZDE2:5'- TGGTAATGGTAGC GACCGGCGCTCAGCTGGAATTCCGCCGATACTGACGG TCAGAAGAACTCGTCAAGAAG-3'(SEQ ID NO.4), the first 50 bases of the primer are the homology arm of the 23-72 position in the opposite direction of the open reading frame of the LacZ gene (indicated by the underline), and the following bases are the neo gene on the pSNR plasmid backend part. A product of 2.7 kb was obtained by PCR amplification, and the PCR amplification system, reaction conditions and recovery method were the same as above.

[0083] 2. The sacB-neoPCR prod...

Embodiment 3

[0107] Example 3. LacZ gene point mutation

[0108] 1. Amplification of the sacB-neo gene cassette with homology arms

[0109] Design primer ZPM1: 5′- ACTGGCCGTCGTTTTACAACGTCGTGACTGGGAA A ACCCTGGCGTTACCC ATCCTTTTATGATTTTCTATC-3' (SEQ ID NO.10), the first 50 bases of the primer are the homology arms of the 20-70 positions of the open reading frame of the LacZ gene (underlined, the latter 22 bases are the front end of the sacB gene on the pSNR plasmid part; ZPM2:5′-G CTATTACGCC AGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTT TCAGAAGAACTCGTCAAGAAG-3', (SEQ ID NO.11), the first 50 bases of the primer are the homology arms of the 20-70 position in the opposite direction of the open reading frame of the LacZ gene (indicated by the underline), and the following bases are the neo on the pSNR plasmid The back end of the gene.

[0110] A product of 2.7 kb was obtained by PCR amplification, and the PCR amplification system, reaction conditions and recovery method were the same as above....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for carrying out gene knock-out or point mutation on a colibacillary genome by an oligonucleotide mediated recombineering measure. The method comprises the following steps: firstly, integrating a gene box of a cane sugar 6-fructosyltransferase gene and a kanamycin resistance gene containing isogenous arms into a target gene through recombineering; and then, carrying out isogenous recombination on oligonucleotide containing the isogenous arms and the isogenous sequences on the genome through the recombineering to remove the cane sugar 6-fructosyltransferase gene and the kanamycin resistance gene. Thereby, the gene knock-out and point mutation without any basic group redundance are realized. The gene knock-out oligonucleotide design conforms to the basic group sequences of both sides of the target genes, and base groups needing the mutation are introduced in the oligonucleotide by the point mutation oligonucleotide. The invention does not need in-vitro clone and in-vitro realization of some basic group bit mutation or mutation gene transplanting into germ bodies. The method of the invention can provide an effective early-stage operation platform for the industrial production and the research such as genetics, molecular biology, biochemistry and the like.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for gene knockout or point mutation of Escherichia coli mediated by oligonucleotides. Background technique [0002] Escherichia coli is an important tool for research in genetics, molecular biology, biochemistry, etc. Its typical features are: rapid growth (doubling time 17 minutes), clear genetic background, diverse genetic manipulation methods, and the genomes of various Escherichia coli have been analyzed, etc. Escherichia coli is also one of the most important strains for industrial production of various active proteins, metabolites (such as amino acids, pigments and alkaloids) and secondary metabolites (such as physiologically active substances). In view of the importance of Escherichia coli, it is very important to develop fast and easy genetic manipulation methods for modifying the genes of Escherichia coli, and gene knockout and point mutation are two key tech...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/01C12R1/19
Inventor尚广东董慧青赵碧玉
OwnerNANJING NORMAL UNIVERSITY