Unlock instant, AI-driven research and patent intelligence for your innovation.

Double expression plasmid of hepatitis B virus, and construction method and application thereof

A technology of hepatitis B virus and construction methods, applied in the direction of antiviral agents, microorganism-based methods, biochemical equipment and methods, etc.

Inactive Publication Date: 2010-09-08
THE FIFTH MEDICAL CENT OF CHINESE PLA GENERAL HOSPITAL
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Scholars currently recognize that the S gene and the C gene are commonly used candidate genes for HBV DNA vaccines, both of which have strong immunogenicity, but the previous vaccines used a single gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Double expression plasmid of hepatitis B virus, and construction method and application thereof
  • Double expression plasmid of hepatitis B virus, and construction method and application thereof
  • Double expression plasmid of hepatitis B virus, and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1 Construction of Hepatitis B Virus Pre-C-C Gene Vaccine

[0071] 1. Nested PCR amplification of ENHII-PreC-C gene

[0072] Select the blood of patients with viral hepatitis, chronic hepatitis B (moderate), positive for HBVDNA and HBeAg. Serum HBV DNA was extracted and sequenced, and typed as adr subtype. Heparin anticoagulant blood of patients with chronic hepatitis B was 3ml, centrifuged at 2000rpm for 3min, and the serum was separated. Using the QIAGEN kit, the steps to extract HBV DNA are as follows:

[0073] ①Mix 200 μl of serum and 20 μl of protease, ②Add 200 μl of Buffer AL, mix evenly, ③Add 200 μl of absolute alcohol, mix evenly, incubate at 56°C for 10 minutes, ④Centrifuge at 10000rpm for 1min, pass through the column, discard the centrifugate, ⑤Add 1500μl of BufferAW, and centrifuge at 10000rpm Rinse for 1 min, discard the centrifugate, ⑥ add 500 l of BufferAW2, centrifuge at 14000 rpm for 5 min, discard the centrifugate, ⑦ centrifuge again at 14000...

Embodiment 2

[0099] Example 2 Construction of the pre-S-S gene vaccine of hepatitis B virus

[0100] 1. Nested PCR amplification of PreS-S-ENH I gene

[0101] Using HBV plasmid G683-1 as template, using S2-5 (forward, 5′-AAACTGCAGCATCCTCAGGCCATG,) and S3E (reverse, 5′-GGATCCCTAGGAGTTCCGCAGTATGG) as primers, the PCR method in Part 1 of Example 1 was used to amplify increase, such as Figure 5 , 1 μl of template, 1 μl of each primer (25 μM), 2 μl of 5mMdNTP, 5 μl of 10×PCR Buffer, 1 μl of Taq enzyme, H 2 O 39μl, denaturation at 94°C for 3min→denaturation at 94°C for 1min, annealing at 52°C for 1min, extension at 72°C for 1min, a total of 35 cycles→extension at 72°C for 10min. The amplified product is the HBVPreS-S-ENH I gene. The size was identified by 1% agarose gel electrophoresis to be about 1.3kb, which was in line with the expected length.

[0102] 2. Construction of recombinant plasmid VES:

[0103] The method is the same as in the second part of Example 1. The PCR product is conn...

Embodiment 3

[0104] Example 3 Insertion Mutation of Recombinant Plasmid VES

[0105] The insertion mutation of the VES plasmid is realized by single primer secondary PCR amplification:

[0106] 1. Synthesize 1 pair of primers for introducing insertion mutations, insert Nhe I, Pac I, Fse I and Age I restriction sites: VR-forward: 5'-GGTGCTGAAGAATTGCTAGCTTAATTAAGGCCGGCCACCGGTTCCTCCTGGG, the sequence is as SEQ ID NO: 5;

[0107] VR-reverse: 5'-TGGCCGGCCTTAATTAAGCTAG, sequence as SEQ ID NO: 6

[0108] (Insert sequence in bold italics)

[0109] 2. The first round of PCR: use the VES plasmid as a template, add forward primer VR-forward, and PCR amplification, the reaction volume and conditions are as follows: template (VES0.1μg / μl) 2μl, primer VR-forward (25μM) 2μl, dNTP (5mM) 2μl, 10×PCR Buffer 2.5μl, Pfu enzyme 1μl, H 2 O16.5 μl, reaction conditions: denaturation at 94°C for 1 min→denaturation at 94°C for 1 min, annealing at 52°C for 1 min, extension at 72°C for 12 min, and extension at 72°...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to double expression plasmid of hepatitis B virus and a construction method thereof. The method comprises the following steps: firstly and respectively taking former C-C gene / self-replication regulatory element enhancer II and former S-S gene / self-replication regulatory element enhancer I of the hepatitis B virus as target genes, using eukaryotic expression vector VR012, constructing ENH II / former C-C gene vaccine recombinant plasmid VEC and ENH II / former S-S gene vaccine recombinant plasmid VES of the hepatitis B, then adopting a single primer secondary PCR method to mutate the recombinant plasmid VES and inserting restriction enzyme cutting sites into the downstream of the expression regulatory unit; and finally, using the inserted restriction enzyme cutting sites, carrying out amplification on the regulatory and expression unit of recombinant plasmid VEC by PCR, enzyme-cutting and recombining the regulatory and expression unit into mutated VES recombinant plasmid, and obtaining two starters which respectively regulate the double expression plasmid for expressing the former C-C gene and the former S-S gene of the hepatitis B virus as DNA vaccines. The recombinant HBV DNA vaccine can effectively express surface antigens and core antigens of the hepatitis B and can be used for prevention and treatment of the hepatitis B.

Description

technical field [0001] The present invention relates to a double expression plasmid vaccine of hepatitis B virus and its construction method and application, in particular to a double expression plasmid of hepatitis B virus pre-C-C (preC-C) gene and pre-S-S (preS-S) gene and its construction method and application, belonging to The biological field of the design and manufacture of HBV DNA vaccine and the detection of immune effect. Background technique [0002] Chronic hepatitis B seriously endangers human health, and there is no effective treatment at present. The main cause of chronicity after hepatitis B virus (HBV) infects the human body is that the infected person lacks an effective specific cellular immune response and cannot clear the virus in the body. Due to the unique advantages of DNA vaccine in inducing the body's specific cellular immunity, it has been widely studied as a potential immunotherapy against chronic hepatitis B. At present, the focus of hepatitis B...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/79A61K48/00A61K39/29A61P31/20C12R1/93
Inventor 貌盼勇沈宏辉辛绍杰王福生胡燕白冰珂侯俊张敏赫兢栾翔玲王志杰
Owner THE FIFTH MEDICAL CENT OF CHINESE PLA GENERAL HOSPITAL