Promoter and expression mode identification of rice endosperm specific expression gene

A promoter and rice technology, applied in the field of plant genetic engineering, can solve the problems of enhancing the expression intensity of the promoter and not being able to determine the specific expression characteristics of the endosperm of the promoter

Active Publication Date: 2010-09-15
HUAZHONG AGRI UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it is also reported in the literature that the GCN4 element only plays a role in enhancing the expression intensity of the promoter in the endosperm, and it does not determine the specific expression characteristics of the promoter in the endosperm (Vickers et al., 2006)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Promoter and expression mode identification of rice endosperm specific expression gene
  • Promoter and expression mode identification of rice endosperm specific expression gene
  • Promoter and expression mode identification of rice endosperm specific expression gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Verification of the expression profile of the endosperm-specific expression candidate gene (Genebank accession number is GI: 31415924)

[0032] Material preparation: The material used in this example is the indica rice variety (Oryza sativa ssp.Indica) Minghui 63 (an excellent rice restorer line widely used in my country), and the planting method is hydroponics. The composition of the nutrient solution is as follows: 1.44mM NH 4 NO 3 , 0.3mM NaH 2 PO 4 , 0.5mM K 2 SO 4 , 1.0 mM CaCl 2 , 1.6mM MgSO 4 , 0.17mM NaSiO 3 , 50μm Fe-EDTA, 0.06μM (NH 4 ) 6 Mo 7 o 24 , 15 μM H 3 BO 3 , 8 μM nCl 2 , 0.12 μM CuSO 4 , 0.12 μM ZnSO 4 , 29 μM FeCl 3 , 40.5 μM Citric acid, pH 5.5 (Yoshida et al., 1976). Take leaves, leaf sheaths, stems, roots and ears at the booting stage, and take endosperm 14 days after fertilization. RNA was extracted using the Trizol Reagent (Invitrogen, Carisbad, CA, USA) method. The total RNA was detected by 1.4% agarose gel electr...

Embodiment 2

[0034] Example 2: Acquisition of endosperm-specific expression promoter EnP3 candidate fragments and corresponding deletion fragments (refer to "Molecular Cloning Experiment Guide (Second Edition)" (J. Sambrook et al., 1996) for routine operations in molecular biology

[0035] Extraction of Minghui 63 Genomic DNA: Take fresh leaves at the peak tillering stage of Minghui 63 to extract its genomic DNA. CTAB) extraction method (Murray and Thompson.1980), the extracted DNA was completely dissolved and stored in a -20°C refrigerator.

[0036] Extract the upstream sequence of the candidate gene GI: 31415924 on the bioinformatics website NCBI (http: / / www.ncbi.nlm.nih.gov / ), specifically -976 to +54 (transcription start point is +1) A total of 1130bp intervals were used as promoter candidate fragments. Name it EnP3. Using the PCR method, using the extracted Minghui 63 genomic DNA as a template, by designing specific primers (EnP3F: AAGCTT GGAGCATTTGTAGGAATGCC; EnP3R: GGATCC ...

Embodiment 3

[0040] Example 3: Construction of transformation vectors for endosperm-specific expression promoter EnP3 candidate fragments and corresponding deletion fragments (refer to J. Sambrook et al., "Molecular Cloning Experiment Guide (Second Edition)" for the corresponding molecular biology routine operations, Science Press (1996).

[0041] (1) Digest vector DX2181. The DX2181 vector was transformed on the basis of pCAMBIA1380 (the vector used by the Australian CAMBIA (Center for the Application of Molecular Biology to International Agriculture, CAMBIA) laboratory in the world for public communication), and at the multiple cloning site with the opposite Direction Constructed a GUS gene and EGFP gene respectively, the vector map and multiple cloning sites and other information can be found in image 3 . Digest DX2181 with HindIII and BamHI, recover the digested product with UNIQ-10 Column DNA Gel Recovery Kit (produced by Shanghai Sangon Bioengineering Technology Service Co., Ltd.)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of plant genetic engineering. Six upstream promoters (EnP3, EnP3-859, EnP3-678, EnP3-471, EnP3-292 and EnP3-110) with different lengths of the same endosperm specific expression gene (access number: GI 3141524) are cloned from a rice genome; and the nucleotide sequences of the promoters are nucleotide sequence SEQ ID No.1, nucleotide sequence SEQ ID No.2, nucleotide sequence SEQ ID No.3, nucleotide sequence SEQ ID No.4, nucleotide sequence SEQ ID No.5 and nucleotide sequence SEQ ID No.6. Five promoters (EnP3, EnP3-859, EnP3-678, EnP3-471 and EnP3-292) are expressed only in endosperms of transgenic plants, and the expression of the five promoters reduces as the endosperms grow; and the expression of the five promoters can be detected in none of leaf blades, leaf sheaths, stalks, roots, flowers, glumes and embryos. The expression of the promoter EnP3-110 can detected in green tissues such as the leaf blades, leaf sheaths, stalks, and glumes, but not in the roots, flowers and seeds (including embryos and endosperms), so the promoter EnP3-110 is a short green tissue specific expression promoter. The invention also discloses a method for preparing the six promoters and the corresponding expression vectors thereof and the use of the six promoters through the transfer of the six promoters into rice by using transgenic method of agrobacterium rhizogenes mediation.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to the isolation and cloning of different length promoter regions of the same endosperm-specific expression gene in rice and the identification of expression patterns. Background technique [0002] Researching and improving crops by means of molecular biology and genetic engineering has a good application prospect in agricultural production. Since the first transgenic tobacco was obtained in 1983 (Zambryski et al., 1983), in the past 30 years, the research on plant genetic engineering has made rapid progress, and has become an important task in modern biology and breeding. methods and techniques. However, some problems have gradually been exposed in the process of its wide application. One of them is that constitutive promoters are often used to drive the expression of exogenous genes in current research, because constitutive promoters will cause the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113A01H5/00
Inventor林拥军叶荣建陈浩
OwnerHUAZHONG AGRI UNIV