Method for detecting human beta-globin gene mutation

A globin and human detection technology, applied in biochemical equipment and methods, microbial determination/inspection, fluorescence/phosphorescence, etc., can solve the problem of difficulty in simultaneous detection of multiple beta-globin gene mutations, cumbersome operations, and low throughput and other problems, to achieve the effect of saving reagents and costs, not easy to contaminate, and easy and fast to operate

Active Publication Date: 2010-12-01
XIAMEN UNIV +1
View PDF5 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The purpose of the present invention is to provide a method for detecting human β-globin gene mutations in order to overcome the shortcomings of the prior art such as cumbersome operation, long time-consuming, low throughput, and difficulty in detecting multiple β-globin gene mutations at the same time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting human beta-globin gene mutation
  • Method for detecting human beta-globin gene mutation
  • Method for detecting human beta-globin gene mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Example 1 Artificially synthesizing different complementary target sequences to investigate the ability of the improved molecular beacon melting curve method to detect mutations in the β-globin gene

[0070] In this example, an improved molecular beacon targeting the TATA box in the promoter region of the β-globin gene was designed, wild-type and target sequences with different point mutations were artificially synthesized, and the improved molecular beacon melting curve method was used to detect β-globin gene mutations Ability. The sequences of the modified molecular beacons and targets used were:

[0071] Probe 1: 5′-FAM-C GGC TGGGCATAAA AGTCAGGGC CG-BHQ-3′

[0072] Target 1: 5′-GCTGCCCTGACTTTTATGCCCAGCCCTG-3′

[0073] Target 2: 5′-GCTGCCCTGACTTCTATGCCCAGCCCTG-3′

[0074] Target 3: 5′-GCTGCCCTGACTTTCATGCCCAGCCCTG-3′

[0075] Target 4: 5′-GCTGCCCTGACTTTTAGGCCCAGCCCTG-3′

[0076] Target 5: 5′-GCTGCCCTGACTTTTTATTCCCAGCCCTG-3′

[0077] Target 6: 5′-GCTGCCCTGAGTTTT...

Embodiment 2

[0081] Example 2 An improved molecular beacon melting point curve method was used to detect point mutations in the TATA box of the promoter region of the human β-globin gene.

[0082] Point mutations in the bases of the TATA box in the promoter region of the β-globin gene will reduce the synthesis of the β-globin peptide chain, resulting in β-thalassemia, such as: -28 mutation from A to G will lead to β+ thalassemia , the mutation of -29 from A to G will also lead to β + Thalassemia.

[0083] This embodiment designs the improved molecular beacon Probe 1 (same as Example 1) of the TATA box in the promoter region of the β-globin gene, using artificially constructed plasmid templates or human genome templates, and after real-time PCR amplification, the melting curve of Probe 1 is performed Analysis, to illustrate that the present invention can be used for the detection of single base mutation.

[0084] The primers used were:

[0085] Primer 1: 5′-CCAATCTACTCCCCAGGAGCA-3′

[0...

Embodiment 3

[0093] Example 3 Detection of human β-globin gene CDs14 / 15(+G) insertion mutation by improved molecular beacon melting point curve method.

[0094] The insertion mutation of β-globin gene CDs14 / 15(+G) causes a shift in the reading frame of the coding region, which leads to premature termination of the synthesis of β-globin peptide chains, resulting in β 0 Thalassemia. The improved molecular beacon Probe 2 designed in this example covers the CDs14 / 15 region of the β-globin gene, and also covers the CDs17 region, where the common CDs17 (A→T) mutation can also cause β 0 Thalassemia. The primers used are Primer 1 and Primer 2 (same as Example 2), and the sequence of Probe 2 is: 5'-ROX-CACGTT CCTGTGGGGCAAGGTGAACGTG - DABCYL-3', wherein the underlined sequence is complementary to the beta-globin gene.

[0095] The PCR reaction system is: 25 μL reaction solution containing 2.5 μL 10X PCR buffer (no Mg 2+ ), 3.0mM MgCl 2 , 0.2 mM dNTP, 1 U hot-start Taq DNA polymerase, 0.2 μM up...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
Login to View More

Abstract

The invention relates to a method for detecting human beta-globin gene mutation, in particular to a method for detecting the beta-globin gene mutation by a modified molecular beacon melting curve. The method comprises the following steps of: designing and preparing a corresponding modified molecular beacon in region of a beta-globin gene needing mutation detection; designing an upstream primer and a downstream primer on the periphery of the designed modified molecule beacon, and performing PCR amplification on fragments containing the region to be detected by using the upstream primer and the downstream primer; and after PCR amplification is finished, analyzing the melting curve, and judging whether a nucleotide sequence to be detected has the gene mutation and possible mutation types according to the change of the melting point of the modified molecular beacon.

Description

technical field [0001] The invention relates to a method for detecting human beta-globin gene mutation, in particular to a method for detecting beta-globin gene mutation by improving the molecular beacon melting curve. Background technique [0002] β-thalassemia (β-thalassemia) is one of the most common single-gene recessive genetic diseases in humans. + ) or completely absent (β 0 ), thus the excess α-globin peptide chain combined with the red blood cell membrane eventually causes hemolytic anemia. The disease has been reported all over the world, and it is widely prevalent in some tropical and subtropical countries and regions, and most provinces and regions south of the Yangtze River in my country (including Taiwan, Hong Kong and Macao) are high-incidence areas of the disease. [0003] Children with beta-thalassemia are usually healthy at birth but develop progressively between 6 months and 2 years of age, and if left undiagnosed and untreated, most die of anemia or inf...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68G01N21/64
Inventor黄秋英李庆阁
OwnerXIAMEN UNIV