Unlock instant, AI-driven research and patent intelligence for your innovation.

shRNA for hepatitis b virus and recombinant adeno-associated virus vector treating vector carrying same

A hepatitis B virus and virus gene technology, applied in the fields of molecular biology and biomedicine, can solve problems such as unsatisfactory treatment effect, and achieve the effects of long duration, stable inhibitory effect, and inhibition of replication

Active Publication Date: 2012-09-05
BEIJING TRI PRIME GENE PHARMA CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The primary purpose of the present invention is to provide a shRNA specific for hepatitis B virus, so as to solve the problem that the anti-HBV drugs currently used in clinical practice, especially other RNAi drugs, have an unsatisfactory therapeutic effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • shRNA for hepatitis b virus and recombinant adeno-associated virus vector treating vector carrying same
  • shRNA for hepatitis b virus and recombinant adeno-associated virus vector treating vector carrying same
  • shRNA for hepatitis b virus and recombinant adeno-associated virus vector treating vector carrying same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: Synthesis and sequence identification of DNA capable of transcribing shRNA.

[0038] According to the common parts of the three subtype sequences of HBV genotypes B, C, and D, the corresponding target sequence of HBV was selected by bioinformatics methods, and a DNA sequence capable of transcribing shRNA in vivo was designed for the target sequence. The DNA sequence was as follows:

[0039] Justice Chain:

[0040] 5′-CACCGCAGTTTACTAGTGCCATTTGTTTCAAGAGAACAAATGGCACTAGTAAACTGTTTT

[0041] TTG-3′

[0042] Antisense strand:

[0043] 5′-GATCCAAAAAACAGTTTACTAGTGCCATTTGTTCTCTTGAAACAAATGGCACTAGTAAAC

[0044] TGC-3′, a synthetic interference plasmid pGPU6-GFP-shRNA, was synthesized by Shanghai Gemma Pharmaceutical Technology Co., Ltd. and sequenced to identify the DNA sequence, such as figure 1 and 2 .

Embodiment 2

[0045] Example 2: Construction of recombinant adeno-associated virus backbone plasmid

[0046] Using pGPU6-GFP-shRNA vector as template, 5′-GAATTCATGGTGAGCAAGGGCGAGGA-3′ and 5′-AAGCTTAAGGTCGGGCAGGAAGAGGG-3′ as upstream and downstream primers, amplify the GFP-shRNA-U6 fragment of plasmid pGPU6-GFP-shRNA, and introduce restriction Sites for endonucleases EcoR I and HindIII. Amplification conditions were: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 sec, annealing at 65°C for 1 min, extension at 72°C for 2 min, a total of 30 cycles, and a final reaction at 72°C for 5 min. After the PCR product was recovered, it was inserted into the pGEM-T vector, and after the sequence identification was correct, it was cloned into the pAAV-MCS plasmid (Stratagene Company) with EcoR I and HindIII double enzyme digestion and sequenced (Shanghai Sangong) to identify positive recombinant clones. Named as the recombinant vector rAAV-shRNA-GFP, such as image 3 .

Embodiment 3

[0047] Example 3: Packaging of recombinant adeno-associated virus

[0048] will be 3×10 6 293T cells were inoculated in a culture dish with a diameter of 10 cm. When the confluence reached 70-80%, each 5-20 ug of rAAV-shRNA-GFP and pAAV-RC (Stratagene Company) and pHelper (Stratagene) three plasmids were co-transfected into 293T cells, and the pAAV-MCS plasmid was used as a negative control to package the pAAV empty virus, and the fresh medium was changed after 6 hours, and the morphological changes of the cells and the changes of the medium color were observed during the period. After continuing to culture for 66-72 hours, scrape the cells from the culture dish with a cell spatula and transfer them together with the culture medium to a 15ml centrifuge tube. The cell suspension was subjected to four back-and-forth 10min dry ice-ethanol baths and 37°C water baths, and vortexed evenly after each freeze-thaw. Centrifuge at 10,000 rpm for 10 min at room temperature, collect the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biomedicine, and relates to a recombinant adeno-associated virus carrying shRNA (shorthairpin RNA, shRNA) with the effect of inhibiting hepatitis B virus, a preparation method thereof and application thereof in preparing medicaments for treating and / or preventing viral diseases. By adopting gene recombination technology, the shRNA with the effect of inhibiting the hepatitis B virus is cloned into skeleton plasmid of an adeno-associated virus vector, and the skeleton plasmid, together with helper plasmid, performs cotransfection on packaging cells to obtain the recombinant adeno-associated virus. The recombinant adeno-associated virus can effectively inhibit the copy and expression of the hepatitis B virus, and has obvious in-vivo inhibition effect, long lasting time and smaller cytotoxicity.

Description

technical field [0001] The present invention relates to the technical field of molecular biology and biomedicine, in particular, the present invention relates to shRNA against hepatitis B virus, carriers carrying it and their application in the preparation of treatment and / or prevention of hepatitis B virus infection. Background technique [0002] There are more than 350 million hepatitis B virus (hepatitis B virus, HBV) carriers in the world, and about 1 million people die from liver diseases caused by HBV infection every year. Chronic hepatitis B virus infection has become a worldwide disease that seriously endangers human health. Chronically infected patients are often treated with interferon and nucleic acid analogues. In clinical application, due to the unsatisfactory therapeutic effect of interferon, the highest response rate is only 40%, and the side effects of nucleic acid analogues and the emergence of drug resistance caused by HBV mutations still need to explore n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113
Inventor 刘金毅徐晨辛娟娟程永庆
Owner BEIJING TRI PRIME GENE PHARMA CO LTD