Construction method for oriented gene transfer vector in compound type liver

A technology of gene transfer and construction method, which is applied in the field of genetic medicine for liver diseases, can solve the problems of low expression time, low gene transfer efficiency, and poor orientation, and achieve the effects of reducing immunogenicity and improving transgene efficiency and orientation

Inactive Publication Date: 2010-12-22
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Comparing the three, the viral vector gene transfection efficiency is high and the stability is strong, but the in vivo application should lead to the antiviral immune rejection mediated by the recipient's complement, thus affecting its repeated in vivo application, expression efficiency and expression time
In addition, its orientation is poor, and its safety has always been concerned; non-viral vectors have the advantages of safety, repeated in vivo application, easy combination with other antibodies, and increased orientation, but their gene transfer efficiency is lower than that of viral vectors; plasmids and cDNAs directly The injection method is the simplest and easy to use, but it has the lowest gene transfer efficiency and the shortest expression time compared with the former two

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method for oriented gene transfer vector in compound type liver
  • Construction method for oriented gene transfer vector in compound type liver
  • Construction method for oriented gene transfer vector in compound type liver

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Preparation method of nano-microcapsule complex

[0021] 1) Obtaining the target gene

[0022] 1. Acquisition of HGF gene

[0023] 1.1 Total RNA extraction and RT-PCR

[0024] Take out 1 g of pre-retained intact human fetal liver with envelope from the -80°C refrigerator, extract the total RNA step by step according to the method in the RNA extraction kit instructions, and put it in the -20°C refrigerator for later use. Using Primer analysis software to analyze the HGF sequence, design a pair of PCR primers: Primer F: 5`CCGGCTTGCAACATTCTT3`; Primer R: 5`TGCTTCAAATACACTGGCCTCTTCTA3`. Add samples in the following order: 10mmoL / L buffer 1μL, 25mmoL / L magnesium chloride 2μL, 10mmoL / L dNTP1μL, RNase 0.2μL, Rtase0.2μL, Tag0.2μL, primer F 0.4μL, primer R 0.4μL, total RNA 3.6μL, DEPC ddH20 1.0 μL. The combined total volume was 10 μL. Reaction conditions: 94°C for 50 seconds, 54°C for 60 seconds, and 72°C for 90 seconds. 35 rounds of amplification. The extracted liver tis...

Embodiment 2

[0094] In Vivo Experiment of Directed Gene Transfer in the Liver Using Nanocapsules

[0095] Nanocapsules are a new type of non-viral vector, which has the advantages of non-toxicity, non-immunogenicity and relative targeting, and has the ability to bind and condense DNA and efficiently introduce DNA into various cells. No obvious cytotoxicity was shown in vitro. Chitosan can effectively combine with plasmid DNA to form nano-microcapsules, and protect it from the degradation of DNase, which has a certain degree of protection for plasmid DNA. Galactose-modified chitosan can be used as a targeted gene release carrier for liver cells. Galactosylated chitosan (GC) is selected, that is, the molecular structure of chitosan is modified with galactose ligands. The body binds to the specific asialoglycoprotein receptor (ASGP-R) on hepatocytes to play the role of liver-directed gene transfer.

[0096] 1 Materials and methods

[0097] 1.1 Materials

[0098] Plasmid pEGFP-N1 was purch...

Embodiment 3

[0105] Experimental Study on Anti-hepatic Fibrosis of Composite Gene Transfer Vector Encapsulated by Nano-microcapsules

[0106] 1. Establishment of mouse liver fibrosis model:

[0107] Using dimethylnitrosamine (dimethylnitrosamine, DMN) to induce mouse liver fibrosis model, referring to the method of Alakkod (Biochen J, 1987, 244: 75-79), dilute DMN to 0.05 with 0.9% (w / v) NaCl % (v / v) concentration, take 2ml and inject intraperitoneally at a dose of 0.05% DMN / kg rat body weight (10 μL DMN / kg rat body weight), once a day, for 3 consecutive days a week, for 4 weeks in total. Tissues were taken for light microscope and electron microscope observation for histopathological identification.

[0108] 2. Gene transfection:

[0109] AsOR-PL-Nanosphere-pAdV.CMV-HGF and pAdV.CMV-asTGFβ1 and pAdV.CMV-HGF-asTGFβ1 directed metastasis in the liver.

[0110] Inbred rats and mice were selected, randomly grouped into groups using anesthesia, and surgical methods were used to inject AsOR-P...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method for an oriented gene transfer vector in a compound type liver. The method is characterized by comprising the following steps: A1, constructing an HGF vector and an asTGF beta1 vector for adenoviruses; A2, constructing a chitose-coated pAdV.CMV-HGF-asTGF beta1 nanosphere virus vector compound; and A3, coating asialoglycoprotein AsOR on the nanoshphere, i.e. the pAdV.CMV-HGF-asTGF beta1 compound. In the invention, a novel oriented gene transfer vector in the compound type liver is constructed so as to reduce the immunogenicity of viral gene vectors, improve the gene transfer efficiency and directionality of non-viral gene vectors.

Description

technical field [0001] The invention relates to the field of gene therapy for liver diseases, in particular to a method for constructing a composite intrahepatic directional gene transfer vector. Background technique [0002] Worldwide, liver cirrhosis has become a major disease second only to cardiovascular and cerebrovascular diseases and malignant tumors, and is extremely harmful to humans. There are more than 1 million liver cirrhosis patients in my country every year, and the treatment effect is not good. Once the patients enter the decompensated stage, the 5-year survival rate is extremely low. The vast majority of chronic liver diseases caused by various etiologies have liver fibrosis, 25%-40% of which eventually develop into liver cirrhosis and even liver cancer. Moreover, liver fibrosis is a necessary stage for the development of various chronic liver diseases to liver cirrhosis. Whether the disease can be terminated at the stage of liver fibrosis or even reversed ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/861C12N15/88
Inventor何勇周峻窦科峰李海民陈勇王德盛岳树强赵威周景师曹大勇
OwnerFOURTH MILITARY MEDICAL UNIVERSITY