Method for producing alpha-acetolacetate decearboxylase by using integrated recombinant bacillus subtilis as strain
A technology of acetolactate decarboxylase and Bacillus subtilis, which is applied in the field of producing α-acetolactate decarboxylase, can solve the problems of using antibiotics, restricting the high-efficiency expression of foreign genes, and unstable replication of plasmids, etc., and achieve the effect of no antibacterial activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0023] This example will include the overlapping promoter P43 promoter derived from Bacillus subtilis (Bacillus subtilis), the α-acetolactate decarboxylase gene signal peptide DNA fragment derived from Bacillus brevis and the DNA fragment derived from Agrobacterium Klebsiella (Klebsiella terrigena) α-acetolactate decarboxylase gene monocistronic α-acetolactate decarboxylase expression elements were cloned into the integrated plasmid pMLK83, and then transformed into host bacteria 1A751 to construct the integrated recombinant Bacillus subtilis, and finally in LB liquid medium Fermentative production of α-acetolactate decarboxylase.
[0024] 1. Construction of recombinant plasmid pMLK83-P43
[0025] According to the promoter P43 sequence annotated in Genbank, the upstream primer was designed as 5'attgctggacgcttatggac 3' and the downstream primer was 5'cgggatccattcctctcttacctataat 3'. PCR reaction system 100ul: DNA template (Bacillus subtilis 1A751 total DNA) 1ul (about 20ng), 5...
Embodiment 2
[0037] This example will contain the promoter derived from the Bacillus lincheniformis maltose amylase gene amyM and the α-acetolactate decarboxylase gene (including signal peptide) monocistronic α derived from Bacillus brevis. - The acetolactate decarboxylase expression element was cloned into the integrated plasmid pMLK83, and then the host strain 1A751 was transformed to construct an integrated recombinant Bacillus subtilis, and finally α-acetolactate decarboxylase was produced by fermentation in LB liquid medium.
[0038] 1. Construction of recombinant plasmid pMLK83-amyM
[0039] According to the promoter amyM sequence annotated in Genbank, the upstream primer was designed as 5'CCCAAGCTTCTGTACACTTGCGTCCTCCA 3' and the downstream primer was 5'cgggatccTCTCCTCCCCTTTCAATGTG 3'. PCR reaction system 100ul: DNA template (Bacillus licheniformis ATCC 14580 total DNA) 1ul (about 20ng), 5×PrimeSTARBuffer 20ul, 10pmol / ul dNTP 2ul, 10pmol / ul forward and reverse primers 2ul each, 2.5U / ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com