Interferon fusion protein, preparation thereof and application thereof

A fusion protein, interferon technology, applied in the direction of peptide/protein components, hybrid peptides, drug combinations, etc., can solve the problems of long half-life therapeutic effect, short half-life, low interferon activity, etc. High and stable effect

Inactive Publication Date: 2011-02-09
夏志南 +1
View PDF3 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In order to overcome the short half-life of the existing interferon in vivo and the low activity of the current long-acting interferon, the present invention provides an interferon fusion protein and its application. The interferon fusion protein can stimulate the body's immune response to viral infection, The long half-life in the body, the maximum therapeutic effect and the reduction of potential side effects of traditional interferon effectively solve the problems existing in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Interferon fusion protein, preparation thereof and application thereof
  • Interferon fusion protein, preparation thereof and application thereof
  • Interferon fusion protein, preparation thereof and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1: Obtaining IFNɑ2a target gene and human IgG2 Fc (hinge region+CH2+CH3) fragment gene

[0060] According to the IFNɑ2a gene sequence (NM_000605), it was sent to Gene Synthesis Company for synthesis. Using the total RNA of normal human lymphocytes as a template, the primers are PFc1: 5' GAC AAG ACC CAC ACC TGTC 3', PFc2: 5' GCCGCCAGATCCGCCTCCGCCCTTTCCGGGGCTCAG 3', RT-PCR amplifies the IgG2 Fc fragment, the reaction process is as follows, reverse transcription reaction : 70°C for 10 minutes, 42°C for 30 seconds, 94°C for 5 minutes and 4°C for cooling. PCR reaction: Denaturation at 94°C for 30 seconds; annealing at 55°C for 30 seconds; extension at 72°C for 1 minute, 30 cycles of reaction. This was followed by an additional extension at 72°C for 5 minutes. After the reaction was completed, RT-PCR products were detected by 1% agarose gel electrophoresis. The flow chart of the whole gene splicing is as follows: figure 1 as shown, figure 2 Indicates that we hav...

Embodiment 2

[0061] Embodiment 2: Construction of recombinant plasmid

[0062] 1) Overlap extension splicing technique (over-lap) to connect IFNɑ2a and Fc genes: Primers were designed as follows: The following primers were designed according to IFNɑ2a and human IgG2 Fc (hinge region+ CH2+ CH3) cDNA sequences:

[0063] PFc1: 5’ GAC AAG ACC CAC ACC TGT C 3’

[0064] PFc2: 5’ GCCGCCAGATCCGCCTCCGCCCTTTCCGGGGCTCAG 3’

[0065]PIFN1: 5'TCTGGCGGCGGAGGAAGTGGCGGAGGCTCTGGCTGCGACCTGCCTCAG 3'

[0066] PIFN2: 5’ CGCGGATCCTCA CTC TTT GGA CTT CAG 3’

[0067] PIFN2 contains a BamH1 restriction site. PFc2 and PIFN1 contain a glycine-serine linking peptide (Gly3Ser) sequence

[0068] 2) PCR reaction system

[0069] Set up the following reaction system in a 50 μl PCR reaction tube

[0070] 10×PCR buffer

5 μl

cDNA

2 μl (10 ng)

PFc1 (10 mM)

2 μl

PFc2: (10 mM)

2 μl

dNTP

4 μl

Taq enzyme

0.5μl (2.5U)

Mg ions

3 μl

[0071] ...

Embodiment 3

[0159] Example 3: Screening and Identification of CHO Stable Expression Strains

[0160] 1) Take 10ug of the pFc-IFNɑ2a plasmid prepared in large quantities in Example 2, and use liposome Lipofectin2000 to transfect CHO cells. Two days later, passaging at a ratio of 1:5, adding 0.4mg / ml G418 for selection, clonal formation can be seen in 10 days. Random digestion of 168 monoclonals with distinct borders and good cell status was inoculated into seven 24-well plate cultures (the first round of screening).

[0161] 2) Use ELISA to detect the expression of the fusion protein on the three-day culture, and select 45 positive clones to inoculate two 24-well plates (the second round of screening) and one 6-well plate (for After 4 days of culture, the supernatant was taken to detect the expression of the fusion protein by ELISA, and 6 clones with higher expression were selected: A2-6, B1-5, C6-3, D5-5, D6-4, D6-5 was further screened by limiting dilution method.

[0162] 3) Inocula...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an interferon fusion protein, preparation thereof and application thereof. The interferon fusion protein is a fusion protein formed by connecting an Fc fragment of the human immunoglobulin G and the human interferon, or connecting the human interferon and the Fc fragment of the human immunoglobulin through a connecting peptide. The preparation of the fusion protein comprises the following steps of: preparing an interferon gene and an Fc fragment gene of the human immunoglobulin G respectively, connecting the interferon gene and the Fc fragment gene and then constructing a recombinant expression vector which contains the connecting fragment; and transforming host cells by using the recombinant expression vector, culturing the host cells, recovering the recombinant fusion protein from cell culturing substances and purifying the recovered product to obtain the recombinant fusion protein. The fusion protein in the invention can be applied in the preparation of antivirus medicaments, antitumor medicaments and immune adjusting medicaments.

Description

technical field [0001] The invention relates to the preparation of recombinant human immunoglobulin crystallizable fragment (Fc) fusion interferon, the interferon prepared by this method can obviously prolong the action time of interferon in vivo, and can be used for the treatment of human related diseases. Background technique [0002] The Fc domain of an antibody typically comprises at least two heavy chain constant region domains per chain, which dimerize to form the Fc domain. The Fc domain is responsible for providing antibody effector functions, including the ability to determine antibody half-life and distribution in vivo, fix complement and bind to cell surface Fc receptors. The properties of the Fc domain make it a useful therapeutic agent. Many studies have fused Fc domains to other non-antibody proteins, such as receptor proteins, such as Enercept, and Fc domain fusions can also be used as research reagents, and Fc tags facilitate protein detection and purificati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61P35/00C07K19/00C12N15/63A61K47/48A61K38/21A61P31/12A61P37/02C12N15/62A61K47/68
Inventor曹鹏夏志南高健
Owner夏志南