Supercharge Your Innovation With Domain-Expert AI Agents!

Humanized HIRRP (HSV-1 Infection Related Repress) protein molecule for resisting HSV1 virus infection

A protein molecule and human-derived technology, applied in the field of human applied basic medicine, can solve the problems of HIRRP protein function reporting and achieve good application prospects

Inactive Publication Date: 2011-02-16
INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

HIRRP protein is one of the protein molecules identified by the above 2-DE protein differential electrophoresis, and the expression in cells is significantly increased after virus infection, but people's understanding of it is almost "zero", and there is no information about HIRRP Research work on protein function is reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Humanized HIRRP (HSV-1 Infection Related Repress) protein molecule for resisting HSV1 virus infection
  • Humanized HIRRP (HSV-1 Infection Related Repress) protein molecule for resisting HSV1 virus infection
  • Humanized HIRRP (HSV-1 Infection Related Repress) protein molecule for resisting HSV1 virus infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] —Acquisition method of HIRRP protein molecules:

[0063] (1) Sample preparation: 24 hours after HSV1 infection, the infected and uninfected L02 cells were collected respectively, and the cell samples were processed according to the kit operation (Promega);

[0064] (2) Two-dimensional electrophoresis (Two2dimensioD Gel Electrophoresis, 2-DE). 300 μg of total cell protein was extracted as the loading sample, and 350 μl of hydration loading buffer was used to swell the IPG strip. The focusing electrophoresis program is: 50V, active hydration for 16 hours; after desalting and boosting process, 10000V focusing for 60000 volt hours. After the focusing is completed, equilibrate in the equilibrium solution for 15 minutes. The gel strips were transferred to the upper end of 12% SDS2PAGE gel for the second dimension protein separation. Start electrophoresis with a low voltage of 70V for 30min, then increase the voltage to 180V, and stop electrophoresis when bromophenol blue r...

Embodiment 2

[0082] ——Clone of HIRRP protein molecule

[0083] Method: HIRRP molecules are basically not expressed in the basic state or physiological level of cells, so the present invention uses 293 cell samples infected with HSV1 virus as a template for amplification.

[0084] (1) Construction of pcDNA3-HIRRP: 293 cell cDNA was used as amplification template, HIRRP-F and HIRRP-R were used as upstream and downstream primers, and the hirrp gene encoding HIRRP protein was obtained by PCR, which was digested by EcoRI and XhoI and then ligated into pcDNA3. The recombinant plasmid was identified by enzyme digestion and sequencing.

[0085] F: aatgaattcatggagcggctccgggagc

[0086] R: atagtcgacagcctgctctcagcttttg

[0087] (2) Construction of pcDNA3-HIRRP-N: Using pcDNA3-HIRRP as a template, pcDNA3-HIRRP-N-terminal F and R as upstream and downstream primers, the gene encoding HIRRP 1-140aa was obtained by PCR, after double digestion with EcoRI and XhoI Connected into pcDNA3, the recombinant p...

Embodiment 3

[0099] ——Expression of HIRRP protein

[0100] method:

[0101] (1) Construction and identification of pGEX-HIRRP: Using pcDNA3-HIRRP as a template, F and R of pGEX-HIRRP as upstream and downstream primers, the hirrp gene was obtained by PCR, and then ligated into pGEX-5X after EcoR I and Sal I double enzyme digestion -1, the recombinant plasmid was identified by enzyme digestion and sequencing.

[0102] (2) A 630bp band was digested by EcoRI and Sal I, and the pGEX-HIRRP recombinant plasmid was successfully constructed by bidirectional sequencing.

[0103] F: aatgaattcatggagcggctccgggagc

[0104] R: atagtcgacagcctgctctcagcttttg

[0105] (3) Expression and purification of HIRRP protein in prokaryotic cells:

[0106] Induction of Escherichia coli Transformed with pGEX-HIRRP Plasmid to Express Foreign Proteins

[0107] ①Transform competent cells BL21(DE3) with plasmids pGEX-5X-1 (as control bacteria) and pGEX-HIRRP respectively, spread the transformed bacteria on LB plates c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an HIRRP (HSV-1 Infection Related Repress) protein molecule with risen expression in a cell after selecting a new virus infection cell from a difference protein expression spectrum of HSV1 virus infection liver L02 cell and a preparation method thereof. The protein molecule is successfully cloned from a liver cell cDNA library. Besides, the invention discovers that the HIRRP protein molecule has specific biological function for resisting HSV1 virus for the first time, and the effective function structural domain of the HIRRP protein is located at the N tail end of the molecule. The research result provides new thought and target for anti-virus prevention and treatment.

Description

technical field [0001] The invention belongs to the technical field of human applied basic medicine. Specifically, the present invention relates to a new antiviral protein HIRRP gene; more specifically, the present invention relates to human protein molecule HIRRP and cDNA full-length anti-HSV1 virus infection Cloning, and its functional determination during HSV1 virus-cell interaction. At the same time, the present invention also defines the possible functional domains of the HIRRP protein. Background technique [0002] Herpes virus is a kind of DNA virus with extremely complex structure, various forms of infection and can cause various clinical and pathological effects. The research on the biological behavior of this kind of DNA virus in basic medicine and clinical medicine has been widely concerned by people, and has important molecular biology, cell biology and clinical medicine significance. Herpesviridae virus particles are generally medium in size and covered with e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/53C12N15/63C07K16/06C07K14/47C12N15/12C07K16/18
Inventor 李琦涵吴练秋刘龙丁董承红王丽春王晶晶赵红玲纳锐雄梁燕张雪梅张莹廖芸
Owner INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More