Method for designing oligonucleotide chip probe and HIV oligonucleotide probe and quality control method thereof

A technology of oligonucleotide probes and design methods, applied in the field of detection reagents, can solve problems such as the inability to directly and effectively evaluate chip quality, and achieve high sensitivity and high efficiency

Inactive Publication Date: 2011-02-23
SOUTHERN MEDICAL UNIVERSITY
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the traditional oligonucleotide probe design is only for the target gene to be detected, none of the above methods can directly and effectively evaluate the quality of chip preparation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for designing oligonucleotide chip probe and HIV oligonucleotide probe and quality control method thereof
  • Method for designing oligonucleotide chip probe and HIV oligonucleotide probe and quality control method thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0026] This example adopts the oligonucleotide probe design method of the present invention to prepare a kind of human immunodeficiency virus (HIV-1) oligonucleotide probe, and its preparation method and process are as follows:

[0027] 1. First, obtain the full-length cDNA sequence of human immunodeficiency virus (HIV-1) B subtype U26942 from the GenBank database, and obtain the conserved sequence of HIV virus through BLAST analysis, and use the biological software Oligo 6.0 to retrieve the obtained BLAST sequences respectively. The conserved sequence of HIV-1B subtype U26942 was analyzed one by one, and an Oligo probe with a length of 50mer was designed according to the design principles of oligonucleotide probes, and its nucleotide sequence was

[0028] ATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCT;

[0029] 2. Then, use the biological software Oligo 6.0 to design a universal sequence with a length of 10mers according to the design principles of oligonucleotide probes:...

example 2

[0042] This example is an example of the application of the human immunodeficiency virus oligonucleotide probe obtained in Example 1 in the quality control of the human immunodeficiency virus chip.

[0043] First, the human immunodeficiency virus oligonucleotide probe obtained in Example 1 was synthesized by a DNA synthesizer, dissolved in the spotting solution, adjusted to a final concentration of 1 μg / μl, and transferred to a 384-well plate for use. Using the Cartesian PixSys 5500 gene chip spotting instrument, the above probes and blank controls were printed on the epoxy-coated glass slides of Corning Company, in which 6 probe points were printed in each line, and the blank controls were printed in lines 3 and 6. To prepare and obtain biochips, the above-mentioned spotting solution is Pronto! TM For epoxy spotting solution, the spotting solution is used as the blank control solution, and the signal of the blank control can represent the spotting process of the chip and the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biology, and relates to a detection method for nucleic acid, in particular to a method for designing an oligonucleotide probe. The method for designing the oligonucleotide probe comprises the following steps of: (1) designing a target gene oligonucleotide probe with length of 50mer aiming at target genes; (2) designing general sequences, the homologies of which are not more than 40 percent compared with the target genes and the lengths of which are 10mer; and (3) connecting the general sequences at two ends of the target gene oligonucleotide probe to construct the oligonucleotide probe respectively. The sequence of the human immunodeficiency virus oligonucleotide probe constructed by adopting the design method of the invention is SEQ ID No: 1. Fluorescence labeled complementary sequences are obtained by fluorescence labeling of the complementary sequences of the obtained general sequences. The fluorescence labeled complementary sequences can be used for detecting the quality of an oligonucleotide chip, have the advantage of high sensitivity, and are particularly suitable for detection chip design of clinical pathogen genes.

Description

technical field [0001] The invention relates to the field of biochemistry, in particular to a detection reagent for a determination or detection method comprising nucleic acid, enzyme or microorganism. Background technique [0002] Oligonucleotide (oligo) probes used in oligonucleotide (oligo) biochips are usually larger than 10mer, such as single nucleotide polymorphism (SNP) probes of about 20mer used for genotyping, and currently more Popular long-chain oligo probes (50, 60, 70mer), this type of chip can quickly design probes to prepare chips based on known sequences, and its detection specificity is high, so it is currently used in the detection and typing of pathogens and gene It has broad application prospects in fields such as expression profiling research. [0003] The stability of the human immunodeficiency virus oligonucleotide biochip, that is, the quality control of the chip preparation, is the primary key issue. The quality control of the gene chip preparation...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/10C12N15/11C12Q3/00
Inventor李凌马文丽郑文岭
OwnerSOUTHERN MEDICAL UNIVERSITY