MicroRNA for inhibiting multiplication of H1N1 influenza virus and application thereof
A technology of H1N1 and influenza virus, which is applied in the field of microRNA and achieves great value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1, discovery of hsa-miR-491-5p and its coding sequence
[0021] 1. Obtaining the nucleotide sequence of hsa-miR-491-5p
[0022] hsa-miR-491-5p sequence (SEQ ID NO: 1): 5'-AGUGGGGAACCCUUCCAUGAGG-3'.
[0023] Coding sequence of hsa-miR-491-5p (SEQ ID NO: 2): 5'-AGTGGGGAACCCTTCCATGAGG-3'.
[0024] 2. Acquisition of Negative Control Nucleotide Sequence
[0025] The nucleotide sequence of nematode cel-let-7 was consulted in the Sanger database (http: / / microrna.sanger.ac.uk / sequences / ) as a negative control sequence.
[0026] The RNA sequence is: 5'-UGAGGUAGUAGGUUGUAUAGUU-3';
[0027] The DNA sequence is: 5'-TGAGGTAGTAGGTTGTATAGTT-3'.
[0028] This negative control has compared human, rat, and rat genome sequences and microRNA sequences by BLAST.
Embodiment 2
[0029] Example 2, construction of hsa-miR-491-5p expression vector
[0030] One, the construction of hsa-miR-491-5p expression vector (recombinant plasmid A)
[0031] Construct the expression sequence of hsa-miR-491-5p into siSTRIKE TM U6 vector (Promega, C7920), siSTRIKE TM The U6 vector itself has cohesive ends.
[0032] The synthetic nucleotide sequence capable of expressing hsa-miR-491-5p and its reverse complementary sequence is as follows (sequence 3 of the sequence listing):
[0033] ACC AGTGGGGAACCCTTCCATGAGG CTTCCTGTCA CCTCATGGAAGGGTTCCCCACT TTTTC
[0034] I II
[0035] *I part sequence is hsa-miR-491-5p nucleotide sequence, II is the reverse complementary nucleotide sequence of I part sequence, which can form a hairpin structure with I part nucleotide sequence.
[0036] The reverse complementary DNA (sequence 4 of the sequence listing) of the DNA shown in sequence 3 is as follows:
[0037] TGCAGAAAA AGTGGGGAACCCTTCCATGAGG TGACAGGAA G CCTCAT...
Embodiment 3
[0051] Example 3. Inhibitory effect of hsa-miR-491-5p sequence on influenza pb1 gene expression
[0052] One, the construction of pb1 expression vector (recombinant plasmid C)
[0053] According to the pb1 gene (GenBank Accession Number: J02178.1), the primer sequence containing the xbaI restriction site was designed, the template was the cDNA of the H1N1 influenza virus (Shanghai Maisha Biotechnology Co., Ltd., B65241G), and the pb1 gene was amplified by PCR from 5 The nucleotide sequence from position 1 to position 2341 at the ' end was cloned into the XbaI restriction site downstream of the luciferase gene in the pRL-TK expression vector (Promega, E2241) to obtain recombinant plasmid C.
[0054] 2. Inhibitory effect of hsa-miR-491-5p sequence on influenza pb1 gene expression
[0055] Treatment 1: use 293T cells (purchased from China Cell Bank Collection Cell Center, QK10428) to lay a 24-well plate; when the cell density in each well reaches 60%, transfect the recombinant p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More