Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Clam ferroprotein gene as well as coding protein and application of in vitro recombinant expression product of same

A technology of ferritin gene and expression products, which is applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of resource destruction of high-intensity harvesting of natural seedlings, etc.

Inactive Publication Date: 2011-05-11
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the national clam breeding area is about 500,000 mu, and the annual demand for seedlings is 10 billion. Due to the high demand for seedlings from farmers, the high-intensity harvesting of natural seedlings has caused great damage to clam resources.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Clam ferroprotein gene as well as coding protein and application of in vitro recombinant expression product of same
  • Clam ferroprotein gene as well as coding protein and application of in vitro recombinant expression product of same
  • Clam ferroprotein gene as well as coding protein and application of in vitro recombinant expression product of same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] A cloned clam ferritin gene has the sequence shown in SEQ ID NO.1.

[0014] The cDNA sequence cloning of clam ferritin gene among the present invention comprises the following steps:

[0015] a) extraction of clam total RNA and purification of mRNA;

[0016] b) Clam cDNA library construction;

[0017] c) determination of the EST sequence of the clam cDNA library;

[0018] d) Homology analysis of clam EST sequences and screening of ferritin gene fragments;

[0019] e) The complete sequence of the ferritin gene was obtained by RACE technology.

[0020] The specific operation is as follows:

[0021] a) Extraction of total RNA from clams and purification of mRNA: total RNA was extracted from clam larvae using Trizol reagent from Invitrogen, and mRNA was purified using Oligotex mRNA purification kit from QIAGENE.

[0022] b) Clam cDNA library construction: using Stratagene company cDNA Synthesis Kit and The Synthesis Kit (Stratagene) was used to synthesize cDNA. The d...

Embodiment 2

[0035] According to the cDNA sequence of SEQ ID NO.1, specific primers were designed. Using primers F2: GCC GGATCCATGGCAGATTCAAGACC and R2: CGCGTCGAC TTAGGATTGCAGTTCTCTGTC, the gene fragment encoding ferritin mature peptide was amplified by PCR, and the reaction was carried out in MJ Research PTC-100. The following cycle: denaturation at 94°C for 45s, annealing at 50°C for 45s, extension at 72°C for 40s, a total of 30 cycles, and finally extension at 72°C for 5min. It was cloned into pGEX-4T-1 expression vector according to the method of "Molecular Cloning Third Edition", and transformed into Escherichia coli BL21(DE3), and the expression frame was confirmed to be consistent with the sequence of SEQ ID NO.1 by sequencing. Inoculate positive clones into LB. medium, shake culture at 37°C until OD 600 0.6-0.8, add 1mM IPTG to induce for 3h, and centrifuge to save the bacterial pellet. The bacterial cells were treated with 1mg / mL egg white lysozyme for 30 minutes and then ultras...

Embodiment 3

[0041] Recombinant ferritin can provide products and technologies for growth regulation and immune enhancement in clam seed production. During seedling production, mature clam broodstock were selected and placed in seawater at 28°C to induce discharge. After the sperm and eggs are naturally fertilized in water, they develop into D-type larvae in about 20 hours. The density of clam larvae is 5 / ml water body, the seawater temperature is 27°C, and the salinity is 25. During the cultivation period, 100% of the water is changed every day, and 20,000 to 50,000 cells / ml of golden algae are fed. After the clams were cultivated to the 4th day, the shell length was about 180 μm. At this time, adding ferritin, the recombinant expression product in Example 2, to the water body can effectively increase the growth rate and metamorphosis rate of clam larvae.

[0042] clam ferritin

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technologies of clam ferroprotein gene cloning and in vitro recombinant expression in molecular biology. In the invention, the expression sequence tag (EST) technology and rapid amplification of cDNA ends (RACE) 3' and 5' are utilized to clone ferroprotein gene cDNA with the total length of 798bp from a clam larva, the cloned ferroprotein gene contains an open reading frame with the length of 513bp, 171 amino acids are coded, the length of a non-coding region 5' is 119bp, the length of a non-coding region 3' is 154bp, a tailing signal is contained, and the gene plays an important role in formation of a shell during development of the clam larva. In the invention, the in vitro prokaryotic recombinant expression technology is utilized to obtain recombinant clam ferroprotein; and the ferroprotein has antioxidant activity, can be used for regulating and controlling formation and growth of shells of shellfish larvae such as clams and the like, and can be applicable to development regulation and immunological enhancement in the shellfish larva production process.

Description

technical field [0001] The present invention relates to clam ferritin gene cloning and in vitro recombination expression technology. Specifically, the EST sequence of ferritin gene is obtained by screening from a larval cDNA library, primers are designed, and the full cDNA sequence of clam ferritin gene is cloned by RACE technology, and The sequence is prokaryotically recombined and expressed, and also relates to the application of the gene and its expression product in larval growth and development regulation and immune regulation in clam seed breeding. Background technique [0002] Ferritin is a typical intracellular protein (Tacchini et al., 1992). Iron ions are stored in ferritin after entering cells through the cell membrane through the iron absorption mechanism, and then released when the body needs iron ions. Ferritin is a hollow spherical macromolecule composed of 24 structurally equivalent subunits, and the hollow part can accommodate up to 4500 iron atoms. There a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C07K14/435A61K38/17A61P37/04A61P43/00
Inventor 刘保忠王晓梅姚学良张继泉相建海
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com