Improved floral-dip method for transforming maize in permeable medium
A flower soaking method and culture medium technology, applied in the field mediated by Agrobacterium, can solve problems such as unreported grass crops
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Embodiment 1, soaking flower method to transform and obtain corn transgenic plant
[0018] 1. Transformation of maize plants by soaking flowers
[0019] 1. Experimental materials
[0020] Agrobacterium strain: the Agrobacterium strain is Ag10, which is preserved in this laboratory. Contains plasmid vector KAT-A1.
[0021] Plasmid: KAT-A1 contains the red fluorescent protein reporter gene AsRed from jellyfish, with the hpt selection marker gene, which can resist Hygmycin antibiotics. The KAT-A1 vector was constructed in our laboratory. (like figure 1 )
[0022] Maize varieties for transformation: varieties cultivated by our company: K12, K36.
[0023] 2. Cultivation of Agrobacterium tumefaciens
[0024] Pick the Agrobacterium containing the target gene frozen in glycerol, draw a line on the YEB+Amp+Rif plate, and culture in the dark at 28° for 2 days. Pick a single colony and inoculate it in 50ml of resistant YEB liquid medium, shake overnight at 28°200rpm. Pipe...
Embodiment 2
[0037] Example 2, Screening and detection of T1 generation transformants
[0038] 1. Antibiotic screening of T1 generation transformants
[0039] The harvested T1 generation seeds were screened with Hygmycin. The transformant was insensitive to Hygmycin because of the hpt resistance gene. The screening concentration of Hygmycin was 20mg / L, and the resistant plants were selected two weeks later for further molecular detection and verification.
[0040] 2. PCR detection of T1 generation transformants
[0041] For the plants showing resistance to Hygmycin, the hpt gene was detected by PCR. Plant genomic DNA was extracted using the CTAB method. According to the sequence of the hpt gene, the PCR amplification primer sequences were designed as follows:
[0042] Primer 1 (upstream primer): 5' TCGGCGAGTACTTCTACACAGC 3'
[0043] Primer 2 (downstream primer): 5'CTGGCAAACTGTGATGGACGAC 3'
[0044]Use primer 1 and primer 2 to amplify the hpt gene with the genomic DNA template of the...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Pre-denatured | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
