Unlock instant, AI-driven research and patent intelligence for your innovation.

One-step detection method of genetic mutation and B-raf genetic point mutation, and kit thereof

A detection method and step-by-step technology, applied in the field of molecular biology, can solve the problems of immature detection methods and lack of gene mutation detection, and achieve the effect of improving detection sensitivity and specificity and reducing operation steps

Active Publication Date: 2011-08-17
JIANGSU MACRO&MICRO TEST MED TECH CO LTD
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, some hospitals and lung cancer centers have begun to set up gene mutation detection institutions dedicated to the clinical diagnosis of lung cancer, but most hospitals in my country do not have the ability to detect gene mutations, and the detection methods are still immature

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • One-step detection method of genetic mutation and B-raf genetic point mutation, and kit thereof
  • One-step detection method of genetic mutation and B-raf genetic point mutation, and kit thereof
  • One-step detection method of genetic mutation and B-raf genetic point mutation, and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1. Primer and probe design

[0025] 1) Enrichment primer design

[0026] Design primers that can amplify 400-500bp fragments, the relevant parameters are: Tm value 65.0°C-68.0°C, GC value 40.0%-65.0%, primer size 23±3bp. The designed enrichment primer sequences are as follows:

[0027] Enrichment upstream primer: CATCCTAACACATTTCAAGCCCCCA (SEQ ID NO: 1)

[0028] Enrichment downstream primer: GAACACTGATTTTTGTGAATACTGGGAAC (SEQ ID NO: 2)

[0029] 2) ARMS primer design

[0030] Design primers that can amplify a fragment of 80-120bp, the relevant parameters are: Tm value 55.0°C-60.0°C, GC value 40.0%-60.0%, primer size 20±3bp. The 3' end of the upstream ARMS primer is located at the mutation site and matches the mutant gene. In order to improve the specificity, a mismatched base is introduced at the fourth base of the 3' end. The designed ARMS primer The sequence is as follows:

[0031] ARMS upstream primer: GGTGATTTTGGTCTAGCTATAGA (SEQ ID NO: 3)

[0032] ARM...

Embodiment 2

[0037] Example 2. One-step detection method of ARMS fluorescent quantitative PCR for mutation enrichment of V600E point mutation

[0038] The mutation enrichment ARMS one-step detection method of the present invention integrates enzyme digestion, PCR enrichment and ARMS fluorescence quantitative PCR technology, that is, enzyme digestion, PCR enrichment and ARMS fluorescence quantitative PCR identification are independently performed in one reaction system, and the specific process is as follows: Put 25 μl of the reaction system including the components in the following table on the PCR machine (wherein the sample genomic DNA is the genomic DNA extracted from colorectal cancer tissue) and incubate at 37°C for 30 minutes, and the endonuclease TspRI specifically digests B-raf The part to be detected of the wild-type allele (this part contains a restriction enzyme recognition site for TspRI), but the part to be detected of the V600E mutant gene of the B-raf gene cannot be digested ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a one-step detection method of genetic mutation, which integrates enzyme cutting, polymerase chain reaction (PCR) enrichment, amplification refractory mutation system (ARMS) fluorescence quantitative PCR; and the method realizes the detection of mutation allele by completing enzyme cutting, PCR enrichment and ARMS fluorescence quantitative PCR in one step through effective temperature and time control.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to enzyme digestion enrichment PCR technology and ARMS fluorescent quantitative PCR technology. Background technique [0002] In recent years, the incidence of tumors has been increasing year by year, and tumors have become the number one killer of human health. Tumors are mainly caused by genetic mutations. Most cancer patients are diagnosed at an advanced stage, and the vast majority of advanced cancer patients have no chance of radical surgical treatment, and the clinical effect of chemotherapy and radiotherapy is not satisfactory. With the advancement of technology, individualized medicine has gradually entered into clinical practice. The determination of an individualized treatment plan depends on the results of gene mutation detection. At present, some hospitals and lung cancer centers have begun to set up gene mutation detection institutions dedicated to the clin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 陈唯军
Owner JIANGSU MACRO&MICRO TEST MED TECH CO LTD