Pseudomonas fluorescens of endophytic fungi of achnatherum inebrians and application thereof to biological control

A technology of Pseudomonas fluorescens and endophytic bacteria, applied in the field of endophytic bacteria, to achieve the effect of safe and reliable prevention and control, no pollution to the environment, and no harm to human health

Inactive Publication Date: 2011-08-31
THE INST OF MICROBIOLOGY XINJIANG ACADEMY OF AGRI SCI
0 Cites 1 Cited by

AI-Extracted Technical Summary

Problems solved by technology

[0007] At present, there is no report on the systematic research on the endophytic bacteria of Drunken Horse Grass. Due to the advantages of easy cultivation, easy control, low production cost, and fast growth, ...
View more

Abstract

The invention discloses pseudomonas fluorescens containing substances with insecticidal activity CGMCC No. 3026 and application thereof to biological control. By separation, screening and culturing in root of achnatherum inebrians, the pseudomonas fluorescens has the optimum insecticidal pH value of 7 to 8, can keep higher insecticidal activity in the pH range of 7.2 to 7.4 and has the insecticidal activity at the temperature of between 20 and 37 DEG C. The strain of the invention is applied in the field of biological control over damage of aphis.

Application Domain

BiocideBacteria +4

Technology Topic

Endophytic fungusPseudomonas trivialis +10

Image

  • Pseudomonas fluorescens of endophytic fungi of achnatherum inebrians and application thereof to biological control
  • Pseudomonas fluorescens of endophytic fungi of achnatherum inebrians and application thereof to biological control
  • Pseudomonas fluorescens of endophytic fungi of achnatherum inebrians and application thereof to biological control

Examples

  • Experimental program(8)

Example Embodiment

[0029] Example 1: Isolation, screening and identification of Claviceps purpurea CGMCC.No3073
[0030] Through the sampling of Zymagrass in Nanshan Mountain of Urumqi, the root, leaf and seed parts of the sample were divided. Sampling at a distance of 10 meters each using a 5-point sampling method (east, south, west, north, center), each point selects one plant to be tested, and each plant has roots, leaves, and seeds (mature period), each Two organs were sampled. Put the sampled organs of different types into food preservation bags and take them back to the laboratory for separation.
[0031] Rinse the sample with sterile water first, then soak with 75% alcohol for 30s, rinse with sterile water, then soak with 0.1% mercury for 1 min, rinse with sterile water three times, add sterile water to grind, and absorb the slurry Coated on beef extract peptone medium, Gao's No. 1 medium, and PDA medium. Beef extract peptone medium and Gao's No. 1 medium are placed in a 37℃ incubator, and PDA is placed in a 27℃ incubator. to cultivate. Connect the sterile water from the last rinse to the three media as a control.
[0032] After the colony grows, perform statistics based on the colony size, color and other characteristics, and streak the different colonies on the corresponding medium until a single colony grows. Check with the microscope to see if the purification is complete.
[0033] The obtained PF-2 colony was round with white hairy hyphae and wrinkles in the middle. The microscopic observation was segmented and the spores were round. According to the "Fungi Identification Manual", the shape, size, and physiological and biochemical reactions of the strain PF-2 were detected. The biological characteristics of the PF-2 strain of the present invention are shown in Table 1.
[0034] Table 1: Physiological and biochemical characteristics of the insecticidal active strain PF-2
[0035] Strain
[0036] PF-2 uses fungal ITS primers:
[0037] ITS1: (5’TCCGTAGGTGAACCTGCGG3’)
[0038] ITS4: (5’TCCTCCGCTTATTGATATGC3’)
[0039] The genomic DNA of PF-2 strain was used as a template for PCR amplification. The PCR reaction conditions were 94°C for 5min, 94°C for 1min, 54°C for 1min, 72°C for 1.5min, 35 cycles, 72°C for 10min. Sequencing. The BLAST program was used to compare and analyze the similarity between the obtained ITS sequence and the sequence in the GenBank database. The results showed that the ITS sequence similarity between strain PF-2 and Pseudomonas fluorescens was the highest, which was 99%, indicating that the two were closely related.
[0040] Through the evolutionary analysis of the homologous ITS sequence of strain PF-2, it is found that it is in the same branch as Pseudomonas fluorescens (ergot furgus) EU55, and its evolutionary topology is shown in the attachment. figure 2 Shown. Combining the morphological and structural characteristics and physiological and biochemical characteristics of PF-2, it is determined to be Claviceps purpurea, see attached figure 1 , 5.

Example Embodiment

[0041] Example 2: Isolation, screening and identification of Pseudomona fluorescenss CGMCC.No3026
[0042] Through the sampling, screening, and separation of Urumqi Nanshan Zhema grass, the specific method can be described in Example 1. See attached image 3 , 5
[0043] The obtained GA colony was round with white hyphae. Microscopic observation showed a long rod shape with mesophytic spores. According to the ninth edition of "Bergey's Manual of Systematic Bacterio-logy" ("Bergey, s Manual of Systematic Bacterio-logy") and "Manual of Common Bacterial System Identification", the shape, size, physiological and biochemical reactions of strain GA were tested. The biological characteristics of the invented GA strain are shown in Table 2.
[0044] Table 2: Physiological and biochemical characteristics of the insecticidal active strain GA
[0045]
[0046] GA uses bacterial universal primers 27F and 1492R:
[0047] 27F: (5’AGAGTTTTATCNTGGCTCAG3’)
[0048] 1492R: (5’GGYTACCTTGTTACGACTT3’)
[0049] The genomic DNA of GA strain was used as a template for PCR amplification. The PCR reaction conditions were 94°C for 5min, 94°C for 40s, 52°C for 40s, 72°C for 1.5min, 30 cycles, 72°C for 7min. Sequencing. The BLAST program was used to compare and analyze the similarity between the 16S rDNA sequence and the sequence in the GenBank database. The results showed that the 16S rDNA sequence similarity between strain GA and Pseudomona fluorescenss was the highest, which was 99%, indicating that the two are closely related.
[0050] Through evolutionary analysis of the homologous 16S rDNA sequence of strain GA, it is found that it is in the same branch as Pseudomonas fluorescens EU364534. See the attachment for its evolutionary topology. Figure 4 Shown. Combined with the morphological and structural characteristics and physiological and biochemical characteristics of GA, it is determined that it is Pseudomona fluorescenss.

Example Embodiment

[0051] Example 3: The growth factor of Claviceps purpurea CGMCC. No 3073
[0052] The strain PF-2 was connected to PDA medium containing different salt (NaCl) concentration, antibiotic (ampicillin) concentration, and pH, and placed in a 28°C incubator for 7 days. Then the strain PF-2 was connected to the PDA medium and placed in 4℃, 10℃, 15℃, 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, 55℃, 60 Cultivate in an incubator at ℃. The results are shown in Table 3.
[0053] Table 3: Effects of temperature, pH, salt and antibiotics on the growth of strain PF-2
[0054] Temperature(℃)
[0055] From Table 3, the strain PF-2 can grow in the environment of temperature 20℃-45℃, pH7-8, NaCl concentration 0.5%-8%, ampicillin concentration 50μg/ml-400μg/ml, especially respectively. It is most suitable for growth when the temperature is 35℃-40℃, pH7, NaCl concentration 7%-8%, and ampicillin concentration 50μg/ml-100μg/ml.

PUM

no PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.

Similar technology patents

Synthesis method of polyepoxysuccinate

Owner:DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI

Pulverized material dust collection chamber

InactiveCN109772565ANot harmful to human healthSimple structure
Owner:永兴县鸿福金属有限公司

Fertilizer special for organic crop planting

Owner:临泉县永庆农作物种植专业合作社

Pesticide made from traditional Chinese medicine

InactiveCN1466879Anot harmful to human healthDoes not pollute the ecological environment
Owner:李子友

Herbicide composition

InactiveCN105145650ANo pesticide residueDoes not pollute the environment
Owner:HUZHOU XULONG BIOCHEM

Classification and recommendation of technical efficacy words

  • not harmful to human health

Pesticide made from traditional Chinese medicine

InactiveCN1466879Anot harmful to human healthDoes not pollute the ecological environment
Owner:李子友

Pulverized material dust collection chamber

InactiveCN109772565ANot harmful to human healthSimple structure
Owner:永兴县鸿福金属有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products